Сайт-специфическая эндонуклеаза BlsI узнает последовательность ДНК 5’-G(5mC)N^GC-3’ и расщепляет ее с образованием 3’-выступающих концов

 

В.А. Чернухин, Ю.Э. Томилова, Е.В. Чмуж, О.О. Соколова, В.С. Дедков, С.Х. Дегтярев

Вестник биотехнологии и физико-химической биологии имени Ю. А. Овчинникова, 2007, т. 3, №1, с. 28-33

 

Из природных изолятов выделен бактериальный штамм Bacillus simplex 23, продуцент сайт-специфической эндонуклеазы BlsI. Этот фермент узнает метилированную последовательность ДНК 5’-G(5mC)N↑GC-3’, как и обнаруженная ранее сайт-специфическая эндонуклеаза BisI (сайт узнавания 5’-G(5mC)↑NGC-3’), но, в отличие от последней, расщепляет ДНК с образованием однонуклеотидных 3’-выступающих концов. Благодаря своей способности расщеплять только метилированную ДНК фермент BlsI может найти практическое применение в генно-инженерных работах, а также для определения статуса метилирования ДНК эукариот.

 

ВВЕДЕНИЕ

В настоящее время известно только три сайт-специфические эндонуклеазы, которые узнают и расщепляют исключительно метилированную ДНК, не требуют кофакторов помимо ионов Mg2+ и, вследствие этого, могут рассматриваться как IIM сайт-специфические эндонуклеазы [1]. Это эндонуклеаза рестрикции DpnI, которая узнает и расщепляет последовательность нуклеотидов 5'-G(mA)↓TC-3' [2] и описанные в наших работах сайт-специфические эндонуклеазы BisI и GlaI, узнающие и расщепляющие нуклеотидные последовательности ДНК 5'-G(5mC)↓NGC-3' [3] и 5'-G(5mC)↓G(5mC)-3' [4], [5], соответственно.
В данной работе описан новый представитель этой группы, фермент BlsI, неошизомер обнаруженной недавно эндонуклеазы BisI [3]. Фермент узнает нуклеотидную последовательность 5’-G(5mC)N↓GC-3’ и расщепляет ее как указано стрелкой с образованием однонуклеотидных 3’-выступающих концов.

 

УСЛОВИЯ ЭКСПЕРИМЕНТА

 

Выращивание штамма-продуцента

Бактериальный штамм Bacillus simplex 23 выделен из почвы в результате направленного систематического поиска штаммов-продуцентов сайт-специфических эндонуклеаз, как описано ранее [6].
Культурально-морфологические и физиолого-биохимические свойства штамма изучали с использованием методик [7]. Штамм идентифицировали по определителю [8], а также с помощью анализа первичной последовательности фрагмента 16S рибосомной РНК [9].
Выращивание штамма проводили в ферментёре при температуре 30°С в 20 л питательной среды, содержащей 1% триптона (Organotechnie, Франция), 0.5% дрожжевого экстракта (Organotechnie, Франция), 0.5% NaCl и 0.05% MgCl2, при рН 7.5 с аэрацией 10 л/мин и перемешиванием 200 об/мин. При достижении культурой поздней логарифмической стадии роста клетки осаждали с помощью центрифугирования при 5000 об/мин при 4°С. В результате получили 100 г биомассы, которую хранили при -20°С.

 


Выделение фермента

Все процедуры выделения фермента проводили при температуре 4°С. 40г сырой биомассы суспендировали в 100 мл буфера А (10 мМ Tris-HCl, pH 7.5, 0.1 мМ ЭДТА, 7mМ β-меркаптоэтанол), содержащего 0.2 М КСl, 0.3 мг/мл лизоцима и 0.1 мМ фенилметилсульфонилфторида (PMSF). Клетки разрушали ультразвуком на дезинтеграторе Soniprep 150 (“MSE”, Англия) 10 раз по 1 мин с интервалами по 1 мин для охлаждения суспензии. Разрушенные клетки осветляли центрифугированием в течение 30 мин при 12000 об/мин. Препарат фермента получали путем хроматографической очистки супернатанта в три стадии на следующих сорбентах: 30 мл фосфоцеллюлозы Р-11 (“Whatman”, Англия), 5 мл гидроксиапатита (“Bio-Rad”, США), 7 мл гепарин-сефарозы (“Bio-Rad”, США).
Супернатант пропускали через колонку с фосфоцеллюлозой Р-11, предварительно уравновешенную буфером А, содержащим 0.2 М КСl. Колонку промывали 60 мл буфера А с 0.2 М КСl, затем линейным градиентом концентрации KCl (0.2 М-1.5 М) в буфере А. Фракции, содержащие эндонуклеазу, объединяли и наносили на колонку с гидроксиапатитом, предварительно уравновешенную буфером В (10 мМ КН2РО4, pH 7.5, 0.1 мМ ЭДТА, 7 мМ β-меркаптоэтанол, 0.2 М КСl). Колонку промывали 10 мл буфера В, затем проводили элюцию белка линейным градиентом концентрации KH2PO4 (0.01 М-0.5 М) в буфере В. Активные фракции объединяли, диализовали против 20 объёмов буфера А и наносили на колонку с гепарин-сефарозой, уравновешенную буфером А с 0.2 М КСl. Колонку промывали 14 мл буфера А, содержащего 0.2 М КСl. Фермент элюировали линейным градиентом концентрации KCl (0.2 М-1 М) в буфере А. Активные фракции объединяли и диализовали против концентрирующего буфера (50% глицерин, 10 мМ Tris-HCl, pH 7.5, 0.1 мМ ЭДТА, 7 мМ β-меркаптоэтанол, 0.2 М KCl). Препарат хранили при -20°С.

 


Выявление активности фермента

В качестве субстрата для определения активности BlsI использовали ДНК плазмиды pFsp4HI1 [9]. Эта плазмида содержит ген ДНК-метилтрансферазы Fsp4HI из Flavobacterium sp. 4H, которая модифицирует первое цитозиновое основание в последовательности нуклеотидов 5'-GCNGC-3' с образованием 5-метилцитозина. Таким образом, плазмида pFsp4HI1 содержит метилированные сайты 5'-G(5mC)NGC-3'.
Как было предварительно установлено, наибольшую активность BlsI проявляет в буфере следующего состава: 10 мМ Трис-HCl, pH 8.5, 5 мМ MgCl2, 100 мМ NaCl и 1 мМ β-меркаптоэтанол с добавлением БСА (бычий сывороточный альбумин) до конечной концентрации 0.1 мг/мл. Поэтому все эксперименты по расщеплению ДНК ферментом BlsI проводили в данном буфере.
Активность сайт-специфической эндонуклеазы BlsI в хроматографических профилях определяли, инкубируя аликвоты из фракций с ДНК плазмиды pFsp4HI1. Для этого к 40 мкл реакционной смеси, содержащей 2 мкг ДНК плазмиды pFsp4HI1 в реакционном буфере, добавляли аликвоту 2 мкл из соответствующей фракции хроматографического профиля. Реакционную смесь инкубировали 30 мин при 30°С. Продукты реакции разделяли в 1%-ном агарозном геле.
За единицу активности (ед) принимали минимальное количество фермента, необходимое для полного расщепления 1 мкг ДНК плазмиды pFsp4HI1 в течение 1 часа при температуре 30°С в 20 мкл реакционной смеси.

 

Определение сайта узнавания и позиций гидролиза ДНК

Специфичность фермента BlsI определяли по картинам специфического расщепления различных ДНК. В качестве субстратов для выявления специфичности расщепления использовали различные ДНК плазмид и фагов, а также синтетические олигонуклеотидные ДНК-дуплексы, содержащие или не содержащие метилированные основания. Сайт узнавания сайт-специфической эндонуклеазы BlsI установили путем сравнения картины гидролиза ДНК плазмиды pFsp4HI1 ферментами BisI и BlsI. Расщепление ДНК проводили в оптимальных условиях (30°С, реакционный буфер - 10 мМ Tris-HCl, pH8.5, 5 мМ MgCl2, 100 мМ NaCl, 1 мМ β-меркаптоэтанол, 0.1 мг/мл БСА) в течение 1 часа. Продукты расщепления плазмидной ДНК разделяли гель-электрофорезом в 1,5% агарозе. Определенный таким образом сайт узнавания был подтвержден в экспериментах по расщеплению синтетических олигонуклеотидных дуплексов.
Позиции гидролиза ДНК сайт-специфической эндонуклеазой BlsI были установлены путем сравнения длин фрагментов, образующихся при расщеплении [32P]-меченного синтетического олигонуклеотидного дуплекса, содержащего сайт узнавания, эндонуклеазами BlsI и BisI. В качестве маркера длин фрагментов использовали продукты частичного расщепления этого же дуплекса экзонуклеазой III из E.coli (ExoIII). Для разделения продуктов гидролиза применяли электрофорез в 20% ПААГ с 7 М мочевиной в трис-боратном буфере.

 

РЕЗУЛЬТАТЫ И ОБСУЖДЕНИЕ

Бактериальный штамм-продуцент фермента BlsI был выделен из образца почвы. Штамм имеет следующие характеристики. На среде Лурия-Бертрани образует белые, гладкие, блестящие, непрозрачные, выпуклые, круглые колонии 4 мм в диаметре. Клетки палочковидные, размером 1х(3-5) мкм, одиночные, в парах или в коротких цепочках. Образуют эллиптические центрально-расположенные споры, не раздувающие спорангий. Грамположительные. Не способны к анаэробному росту, каталазоположительные, оксидазоотрицательные. Растут при температуре 10-40°С. На основании анализа морфологических и биохимических свойств, а также с помощью анализа первичной последовательности фрагмента 16S рибосомной РНК, штамм идентифицировали как вид бактерии Bacillus simplex 23, а продуцируемую им сайт-специфическую эндонуклеазу назвали BlsI.
Фермент выделяли из клеточного экстракта путём последовательных хроматографических процедур, как описано в разделе "Условия эксперимента". Выход фермента составил 200 ед/г сырой биомассы, удельная активность - 1000 ед/мл.
Эндонуклеаза BlsI не гидролизует стандартные вирусные и плазмидные ДНК, используемые для нахождения и определения активности эндонуклеаз рестрикции, такие как ДНК фагов λ и Т7, аденовируса-2, плазмид pUC19 и pBR322. В экспериментах по расщеплению ДНК были протестированы также плазмиды, содержащие гены некоторых бактериальных метилаз, модифицирующих цитозиновые основания в ДНК: M.Fsp4HI метилирует ДНК с образованием последовательности 5’-G(5mC)NGC-3’) [10], M.HspAI модифицирует ДНК с образованием последовательности 5’-G(5mC)GC-3’ [5], M.FauIA и M.FauIB метилируют ДНК о образованием последовательностей 5’-C(5mC)CGC-3’ и 5’-G(5mC)GGG-3’, соответственно [11]. Результаты показали, что фермент BlsI специфически расщепляет только ДНК плазмиды pFsp4HI1, которая метилирована по сайтам 5'-GCNGC-3', благодаря содержащемуся в ней гену метилазы Fsp4HI, тогда как в случае остальных плазмид гидролиз ДНК не происходит. Таким образом, полученные данные указывают на то, что фермент BlsI обладает специфичностью к определенной последовательности ДНК, содержащей 5-метилцитозиновые основания.
На рисунке 1 представлены результаты расщепления ДНК плазмид pUC19 и pFsp4HI1 сайт-специфической эндонуклеазой BlsI. Исходная плазмида pUC19 не содержит метилированных цитозиновых оснований в последовательности 5’-GCNGC-3’ и, как видно из электрофореграммы, она не расщепляется эндонуклеазой BlsI. Плазмида pFsp4HI1 включает в себя ген ДНК-метилтрансферазы M.Fsp4HI, которая метилирует первое цитозиновое основание в последовательности 5'-GCNGC-3'. Таким образом, эта плазмида содержит только метилированные последовательности 5’-G(5mC)NGC-3’ и, как видно из рисунка, расщепляется ферментом BlsI, причем образовавшиеся в результате гидролиза фрагменты ДНК идентичны фрагментам, получаемым при расщеплении той же плазмиды ферментом BisI. Полученные данные доказывают, что сайт-специфическая эндонуклеаза BlsI расщепляет только метилированную ДНК, причем узнаваемая последовательность нуклеотидов совпадает с таковой для фермента BisI. Таким образом, сайтом узнавания сайт-специфической эндонуклеазы BlsI является метилированная последовательность 5'-G(5mC)NGC-3'.

b_320_200_16777215_00_Pics_paper25_fig1.jpg

 

 

Рис. 1. Сравнение длин фрагментов, образуемых при расщеплении плазмидных ДНК pFsp4HI1 (A) и pUC19 (B) эндонуклеазами BlsI (дорожка 1) и BisI (дорожка 2). Электрофорез в 1,5% агарозном геле. К - плазмидная ДНК pFsp4HI1 без гидролиза, M - маркер молекулярного веса 1 Kb (НПО «СибЭнзим») со следующими длинами фрагментов ДНК (т.п.н.): 10; 8; 6; 5; 4; 3х2; 2.5; 2; 1.5; 1х3; 0.75; 0.5х2; 0.25

 

 



Для подтверждения этих данных и определения места гидролиза ДНК, были проведены эксперименты по расщеплению синтетических олигонуклеотидных дуплексов, содержащих метилированный или неметилированный сайт узнавания (последовательность 5’-GCNGC-3’ подчеркнута):

 

NN01: 5’ GCTTGTACTTTAGCGGCATTGATTCTCACCACG 3’
NN02: 5’ CGTGGTGAGAATCAATGCCGCTAAAGTACAAGC 3’
NN1: 5’ GCTTGTACTTTAG(5mC)GGCATTGATTCTCACCACG 3’
NN2: 5’ CGTGGTGAGAATCAATG(5mC)CGCTAAAGTACAAGC 3’



Как видно из рис.2, эндонуклеаза BlsI расщепляет дуплекс NN1*/NN2, содержащий метилированную последовательность 5’-GCNGC-3’, но не расщепляет дуплекс NN01*/NN02, который содержит такую же неметилированную последовательность. Таким образом, BlsI действительно расщепляет лишь метилированные нуклеотидные последовательности 5'-G(5mC)NGC-3'.

b_320_200_16777215_00_Pics_paper25_fig2.jpg

 

 

 

Рис. 2. Расщепление олигонуклеотидных дуплексов NN01*/NN02 (a) и NN1*/NN2 (b) эндонуклеазами Fsp4HI (сайт узнавания 5’-GCNGC-3’) (дорожка 2) и BlsI (дорожка 3). Дорожка 1 - дуплекс без гидролиза. Меченные олигонуклеотиды отмечены знаком *

 

 



Определение места расщепления ДНК сайт-специфической эндонуклеазой BlsI осуществляли путем сравнения длин фрагментов, образующихся при расщеплении олигонуклеотидного дуплекса NN1/NN2 эндонуклеазами BlsI и BisI (рис. 3).

b_320_200_16777215_00_Pics_paper25_fig3.jpg

 

 

Рис. 3. Расщепление олигонуклеотидных дуплексов NN1*/NN2 (a) и NN2*/NN1 (b) эндонуклеазами BlsI (дорожка 2) и BisI (дорожка 4). Дорожка 1 - дуплекс без гидролиза. Дорожка 3 - дуплекс гидролизованный экзонуклеазой III из E. coli. Меченные олигонуклеотиды отмечены знаком *

 

 

 


Из рисунка видно, что длины продуктов расщепления ДНК этими ферментами различаются на 1 нуклеотид. При расщеплении ДНК эндонуклеазой BlsI образуется более длинный 5’-меченый олигонуклеотидный фрагмент, что свидетельствует о смещении места расщепления ДНК эндонуклеазой BlsI на 1 нуклеотид в сторону 3’-конца по сравнению с местом расщепления ДНК эндонуклеазой BisI. Таким образом, BlsI расщепляет последовательность узнавания как показано стрелками:


5' - G(5mC) N↓ G C - 3'
3' - C G↑N(5mC)G - 5'


Работа по изучению способности BlsI расщеплять сайт узнавания с различным распределением метилированных цитозиновых оснований будет описана отдельно.
В настоящей работе охарактеризована новая сайт-специфическая эндонуклеаза BlsI, являющаяся неошизомером фермента BisI. Фермент BlsI относится к редкой группе сайт-специфических эндонуклеаз, которые узнают и расщепляют только метилированную ДНК. Эндонуклеазы BisI и BlsI узнают нуклеотидную последовательность 5’-G(5mC)NGC-3’, но BlsI, в отличие от BisI [3], расщепляет ее с образованием однонуклеотидных 3’-выступающих концов. Следует отметить, что BlsI - это первый обнаруженный представитель данной группы ферментов, расщепляющий ДНК с образованием 3’-выступающих концов.
Так как оба фермента BisI и BlsI обнаружены в бактериальных штаммах, относящихся к роду Bacillus, можно предположить, что их существование в клетках этого рода микроорганизмов играет какую-то особую роль, характерную для клеток Bacillus. Наиболее вероятным представляется высказанное нами ранее предположение, что эти ферменты обеспечивают защиту бактерий от заражения фагами, содержащими метилированную ДНК [3]. Известно, что ряд бактериофагов, размножающихся именно на бактериальных клетках рода Bacillus, содержит гены сайт-специфических ДНК-метилтрансфераз, что приводит к метилированию ДНК фагов по ряду нуклеотидных последовательностей, в том числе и по сайту 5’-GCNGC-3’ [12]. В этом случае роль ферментов BisI и BlsI может заключаться в расщеплении проникающей в клетку метилированной ДНК бактериофагов и предотвращении, таким образом, заражения клетки вирусом.
Мы полагаем, что BisI и BlsI могут найти применение для выявления и анализа метилированных участков ДНК эукариот, которые обычно содержат значительную долю 5-метилцитозиновых оснований. Как известно, метилирование ДНК играет значительную роль в регуляции клеточных процессов, но до сих пор остается недостаточно изученным [13].



Патент РФ № 2322494 C1

 

СПИСОК ЛИТЕРАТУРЫ

  1. Roberts, R.J., Belfort, M., Bestor, T., Bhagwat, A.S., Bickle T.A., et al. // Nucleic Acids Res. - 2003. - V. 31. - P. 1805-1812.
  2. Lacks, S., and Greenberg, B.J. // Biol. Chem. - 1975. - V. 250. - P. 4060-4066.
  3. Чмуж Е.В., Каширина Ю.Г., Томилова Ю.Э., Мезенцева Н.В., Дедков В.С., Гончар Д.А., Абдурашитов М.А., Дегтярев С.Х. // Биотехнология. - 2005. - № 3. - С. 22-26. (интернет-версия)
  4. Чернухин В.А., Наякшина Т.Н., Абдурашитов М.А., Томилова Ю.Э., Мезенцева Н.В., Дедков В.С., Михненкова Н.А., Гончар Д.А., Дегтярев С.Х. // Биотехнология. - 2006. - № 4. - С. 23-28. (интернет-версия)
  5. Томилова Ю.Э., Чернухин В.А., Дегтярев С.Х. // Вестник биотехнологии и физико-химической биологии имени Ю.А.Овчинникова, - 2006 - т.2. - № 1. - C. 30-39. (интернет-версия)
  6. Белавин П. А., Дедков В. С, Дегтярев С. X. // Прикладная биохимия и микробиология. - 1988.- Т. 24. - № 1. - С. 121-124. (интернет-версия)
  7. Руководство к практическим занятиям по микробиологии / Под ред. Н.С. Егорова. - М., 1995.
  8. Определитель бактерий Берджи / Под ред. Хоулта Дж. и др.: 9-е издание в 2-х томах: Пер. с англ. под ред. акад. РАН Г.А. Заварзина. - М., 1997.
  9. Madden, T.L., Tatusov, R.L., Zhang, J. // Meth. Enzymol. - 1996. - V. 266. - P. 131-141.
  10. Чмуж Е.В., Каширина Ю.Г., Томилова Ю.Э., Чернухин В.А., Охапкина С.С., Гончар Д.А., Дедков В.С., Абдурашитов М.А., Дегтярев С.Х. // Молекулярная биология. - 2007. - Т. 41. - № 1. - С. 4.
  11. Чернухин В.А., Каширина Ю.Г., Суханова К.С., Абдурашитов М.А., Гончар Д.А., Дегтярев С.Х. // Биохимия - 2005. - т. 70. - № 6. - C.829-837.
  12. Lange, C., Noyer-Weidner, M., Trautner, T.A., Weiner, M., Zahler, S.A. // Gene. - 1991. - V. 100. - P. 213-218.
  13. Costello, J.F., and Plass, C. // J. Med. Genet. - 2001. - V. 38. - P. 285-303.