Новая сайт-специфическая эндонуклеаза GluI узнает метилированную последовательность ДНК 5’-G(5mC)^NG(5mC)-3’/ 3’-(5mC)GN^(5mC)G-5’

 

В.А. Чернухин, Е.В. Чмуж, Ю.Э. Томилова, Т.Н. Наякшина, Д.А. Гончар, В.С. Дедков, С.Х. Дегтярев

Вестник биотехнологии и физико-химической биологии имени Ю. А. Овчинникова, 2007, Т. 3, №2, с. 13-17

 

Из бактериального штамма Glacial ice bacterium GL24 была выделена и охарактеризована новая сайт-специфическая эндонуклеаза GluI. Этот фермент узнает метилированную последовательность ДНК 5’-G(5mC)^NG(5mC)-3’/3’-(5mC)GN^(5mC)G-5’ расщепляет ее, как указано стрелкой. Благодаря своей способности расщеплять только высокометилированную ДНК фермент GluI может найти практическое применение в генно-инженерных работах, а также для определения статуса метилирования ДНК эукариот.

 

ВВЕДЕНИЕ

В настоящее время известно только четыре сайт-специфические эндонуклеазы, которые узнают и расщепляют исключительно метилированную ДНК, не требуют кофакторов помимо ионов Mg2+ и, вследствие этого, могут рассматриваться как IIM сайт-специфические эндонуклеазы [1]. Это эндонуклеаза рестрикции DpnI, которая узнает и расщепляет последовательность нуклеотидов 5'-G(mA)↓TC-3' [2], и описанные в наших работах сайт-специфические эндонуклеазы BisI, GlaI и BlsI, узнающие и расщепляющие нуклеотидные последовательности ДНК 5'-G(5mC)↓NGC-3' [3], 5'-G(5mC)↓G(5mC)-3'/3'-(5mC)G↓(5mC)G-5' [4], [5] и 5'-G(5mC)N↓GC-3' [6], соответственно.
В данной работе описан новый представитель этой группы, фермент GluI, являющийся изошизомером сайт-специфической эндонуклеазы BisI [3], однако требующий для проявления активности более глубокого метилирования сайта узнавания. Фермент GluI узнает нуклеотидную последовательность ДНК 5’-G(5mC)↓NG(5mC)-3’/3’-(5mC)GN↓(5mC)G-5’ и расщепляет ее как указано стрелкой с образованием однонуклеотидных 5’-выступающих концов.

 

УСЛОВИЯ ЭКСПЕРИМЕНТА

 

Выращивание штамма-продуцента

Выращивание штамма проводили в ферментёре 1601-013 (LKB, Швеция) при температуре 30°С в 20 л питательной среды, содержащей 1% триптона (Organotechnie, Франция), 0.5% дрожжевого экстракта (Organotechnie, Франция), 0.5% NaCl и 0.05% MgCl2, при рН 7.5 с аэрацией 10 л/мин и перемешиванием 200 об/мин. При достижении культурой поздней логарифмической стадии роста клетки осаждали с помощью центрифугирования при 5000 об/мин при 4°С. В результате получили 100 г биомассы, которую хранили при -20°С.


Выделение фермента

Все процедуры выделения фермента проводили при температуре 4°С. 100г сырой биомассы суспендировали в 250 мл буфера А (10 мМ Tris-HCl, pH 7.4, 0.1 мМ ЭДТА, 7 мМ β-меркаптоэтанол, 0.01 % Тритон Х-100), содержащего 0.05 М NaСl, 0.1 % Тритон Х-100, 0.1 мг/мл лизоцима и 1 мМ фенилметилсульфонилфторид (PMSF). Клетки разрушали ультразвуком на дезинтеграторе Soniprep 150 (“MSE”, Англия) 10 раз по 1 мин с интервалами по 1 мин для охлаждения суспензии. Лизат осветляли центрифугированием в течение 30 мин при 12000 об/мин на центрифуге J-2-21 (Beckman, США). Препарат фермента получали путем хроматографической очистки экстракта в четыре стадии на следующих сорбентах: 100 мл фосфоцеллюлозы Р-11 (“Whatman”, Англия), 15 мл гидроксиапатита (“Bio-Rad”, США), 4 мл гепарин-сефарозы (“Bio-Rad”, США), 10 мл гидроксиапатита (“Bio-Rad”, США).
Первоначально супернатант наносили на колонку с фосфоцеллюлозой Р-11, предварительно уравновешенную буфером А, содержащим 0.05 М NaСl. Колонку промывали 200 мл буфера А с 0.05 М NaСl, затем 1000 мл линейного градиента концентрации NaCl (0.2 М - 0.95 М) в буфере А, собирая фракции по 10 мл. Фракции, содержащие эндонуклеазу, объединяли и наносили на колонку с гидроксиапатитом, предварительно уравновешенную буфером В (5 мМ КН2РО4, pH 7.2, 0.1 мМ ЭДТА, 7 мМ β-меркаптоэтанол, 0.01 % Тритон Х-100) с 0.02 М NaCl. Колонку промывали 30 мл буфера В, содержащего 0.02 М NaCl, затем проводили элюцию белка линейным градиентом концентрации КН2РО4 (0.005 М - 0.2 М) в буфере В объемом 400 мл, собирая фракции по 10 мл. Активные фракции объединяли, диализовали против 20 объёмов буфера А с 0.02 М NaCl и наносили на колонку с гепарин-сефарозой, уравновешенную буфером А с 0.2 М NaСl. Колонку промывали 8 мл буфера А, содержащего 0.2 М NaСl. Фермент элюировали линейным градиентом концентрации NaCl (0.2 М – 0.9 М) в буфере А объемом 120 мл, собирая фракции по 3 мл. Фракции, содержащие целевую активность, объединяли и наносили на колонку с гидроксиапатитом, предварительно уравновешенную буфером В с 0.02 М NaCl. Колонку промывали 20 мл буфера В, содержащего 0.02 М NaCl. Элюцию сорбированного материала проводили линейным градиентом концентрации КН2РО4 (0.005 М - 0.17 М) в буфере В объемом 320 мл, собирая фракции по 6,4 мл. Активные фракции объединяли и диализовали против концентрирующего буфера (50% глицерин, 10 мМ Tris-HCl, pH 7.4, 0.1 мМ ЭДТА, 7 мМ β-меркаптоэтанол, 0.01 % Тритон Х-100, 0.1 М NaCl). Препарат хранили при -20°С.


Определение активности фермента

В качестве субстрата для определения активности GluI использовали ДНК плазмиды pFsp4HI3, которая является производной плазмиды pFsp4HI2 [7]. Последняя содержит ген ДНК-метилтрансферазы Fsp4HI из Flavobacterium sp. 4H, которая модифицирует первое цитозиновое основание в последовательности нуклеотидов 5'-GCNGC-3' [7]. Таким образом, плазмида pFsp4HI2 содержит метилированные сайты 5'-G(5mC)NGC-3'. Плазмида pFsp4HI3 была получена в результате встраивания в плазмиду pFsp4HI2 по сайтам HindIII и Bsp19I следующего синтетического олигонуклеотидного дуплекса:


5’ CATGGGCCGCGGCAGCTCGAATTCTAGA          3’
3’          CCGGCGCCGTCGAGCTTAAGATCTTCGA 5’.



Полученная плазмида pFsp4HI3 отличается от pFsp4HI2 четырехнуклеотидной заменой (в структуре дуплекса соответствующие нуклеотиды выделены жирным шрифтом), в результате которой образуется последовательность нуклеотидов 5’-GCСGCGGCAGC-3’ (в структуре дуплекса эта последовательность подчеркнута), представляющая собой три перекрывающихся сайта 5’-GCNGC-3’. Поскольку плазмида включает в себя ген ДНК-метилтрансферазы M.Fsp4HI, модифицирующей все эти три сайта, то в итоге в плазмиде появляется нуклеотидная последовательность 5’-G(5mC)GG(5mC)-3’/3’-(5mC)GC(5mC)G-5’, содержащая 4 метилированных цитозиновых остатка и представляющая собой полностью метилированный сайт узнавания.
Как было предварительно установлено, наибольшую активность GluI проявляет в буфере следующего состава: 10 мМ Tris-HCl, pH 9.0, 7.5 мМ MgCl2, 75 мМ NaCl, 1 мМ β-меркаптоэтанол. Поэтому все эксперименты по расщеплению ДНК ферментом GluI проводили в данном буфере.
Активность сайт-специфической эндонуклеазы GluI в хроматографических профилях определяли, инкубируя аликвоты из фракций с ДНК плазмиды pFsp4HI3, линеаризованной рестриктазой BglII. Для этого к 10 мкл реакционной смеси, содержащей линеаризованную ДНК плазмиды в реакционном буфере, добавляли аликвоту 2 мкл из соответствующей фракции хроматографического профиля. Реакционную смесь инкубировали 30 мин при 37°С. Продукты реакции разделяли в 1%-ном агарозном геле.
За единицу активности (е.а.) принимали минимальное количество фермента, необходимое для полного расщепления 1 мкг ДНК плазмиды pFsp4HI3, гидролизованной эндонуклеазой рестрикции BglII, в течение 1 часа при температуре 37°С в 50 мкл реакционной смеси.


Определение сайта узнавания и позиций гидролиза ДНК

Для определения специфичность GluI проводили гидролиз различных ДНК. В качестве субстратов для определения специфичности фермента использовали ДНК плазмид и фагов, а также синтетические олигонуклеотидные ДНК-дуплексы, содержащие или не содержащие метилированные основания.
Позиции гидролиза ДНК сайт-специфической эндонуклеазой GluI были установлены путем сравнения длин фрагментов, образующихся при расщеплении [32P]-меченных синтетических олигонуклеотидных дуплексов эндонуклеазами GluI и BisI. В качестве маркера длин фрагментов использовали продукты частичного расщепления этих же дуплексов экзонуклеазой III из E.coli (ExoIII).
Расщепление ДНК проводили в оптимальных условиях (37°С, реакционный буфер – 10 мМ TrisHCl, pH 9.0, 7.5 мМ MgCl2, 75 мМ NaCl, 1 мМ β-меркаптоэтанол) в течение 1 часа. Продукты расщепления плазмидной и фаговой ДНК разделяли гель-электрофорезом в 1,2% агарозе. Фрагменты ДНК, образующиеся в результате расщепления олигонуклеотидных дуплексов, разделяли путем электрофореза в денатурирующем 20% полиакриламидном геле (ПААГ) с 7 М мочевиной.

 

РЕЗУЛЬТАТЫ И ОБСУЖДЕНИЕ

Новый фермент GluI был выделен из неидентифицированной бактерии Glacial ice bacterium GL24 из коллекции микроорганизмов НПО «СибЭнзим». Штамм Glacial ice bacterium GL24 характеризуется следующими признаками:
Клетки представляют собой Грамм-положительные аэробные нерегулярные, мелкие палочки, размером 0,5-(1-1,5) мкм, одиночные и образующие палисадные скопления, неподвижные, не образующие спор. На среде Лурия-Бертрани (ЛБ) образует светло-коричневые, полупрозрачные небольшие (1-2 мм), округлые с ровными краями колонии. Температура роста – от 10 до 30°С. Клетки продуцируют каталазу. Оксидаза не обнаружена.
Сайт-специфическую эндонуклеазу GluI, продуцируемую штаммом Glacial ice bacterium GL24, выделяли из клеточного экстракта путём последовательных хроматографий на сорбентах, как описано в разделе "Условия эксперимента". Выход фермента составил 200 е.а./г сырой биомассы, концентрация – 1000 е.а./мл.
Эндонуклеаза GluI не гидролизует стандартные вирусные и плазмидные ДНК, используемые для нахождения и определения активности эндонуклеаз рестрикции, такие как ДНК фагов λ(dam+/dcm+ и dam-/dcm-), Т7, аденовируса-2, плазмид pUC19 и pBR322. В экспериментах по расщеплению ДНК были протестированы также плазмиды, содержащие гены некоторых бактериальных метилаз, модифицирующих цитозиновые основания в ДНК: M.Fsp4HI метилирует ДНК с образованием последовательности 5’-G(5mC)NGC-3’) [7], M.HspAI модифицирует ДНК с образованием последовательности 5’-G(5mC)GC-3’ [5], M.FauIA и M.FauIB метилируют ДНК о образованием последовательностей 5’-C(5mC)CGC-3’ и 5’-G(5mC)GGG-3’, соответственно [8]. При инкубации плазмид, несущих гены данных метилаз, с препаратом GluI гидролиз ДНК также не наблюдается. Фермент GluI расщепляет только ДНК плазмиды pFsp4HI3, полученной как указано в разделе "Условия эксперимента". Эта плазмида, благодаря имеющемуся в ней гену метилазы Fsp4HI, содержит метилированные последовательности 5'-G(5mC)NGC-3', а также один полностью метилированный сайт 5’-G(5mC)NG(5mC)-3’/3’-(5mC)GN(5mC)G-5’.
На рисунке 1 представлены результаты гидролиза ДНК плазмид pFsp4HI2 и pFsp4HI3, линеаризованных различными эндонуклеазами рестрикции, сайт-специфической эндонуклеазой GluI. Как видно из рисунка, плазмида pFsp4HI2 полностью расщепляется ферментом BisI, для которого последовательность 5'-G(5mC)NGC-3' является каноническим сайтом узнавания [3]. Фермент GluI не расщепляет плазмиду pFsp4HI2, однако, он гидролизует ДНК плазмиды pFsp4HI3. Для определения места расщепления ДНК проводили совместный гидролиз ДНК плазмиды pFsp4HI3 сайт-специфической эндонуклеазой GluI и рестриктазами PciI, DseDI и BglII (рис. 1). Сравнение длин фрагментов ДНК, получаемых при совместном гидролизе, показывает, что расщепление ДНК эндонуклеазой GluI происходит в сайте 5’-G(5mC)GG(5mC)-3’/3’-(5mC)GC(5mC)G-5’.

b_320_200_16777215_00_Pics_paper24_fig1.jpg

 

 

Рис. 1. Расщепление плазмидных ДНК эндонуклеазами GluI (дорожка 2) и BisI (дорожка3).
a - плазмида pFsp4HI3, линеаризованная PciI, b - плазмида pFsp4HI3, линеаризованная DseDI, c - плазмида pFsp4HI3, линеаризованная BglII, d - плазмида pFsp4HI2, линеаризованная BglII, Дорожка 1- соответствующая плазмида без гидролиза. M - маркер молекулярного веса 1 Kb (СибЭнзим) со следующими длинами фрагментов ДНК (т.п.н.): 10; 8; 6; 5; 4; 3х2; 2,5; 2; 1,5; 1х3; 0,75; 0,5х2; 0,25

 



Для подтверждения этих данных и определения места гидролиза ДНК, были проведены эксперименты по расщеплению синтетических олигонуклеотидных дуплексов, содержащих последовательность 5’-GCNGC-3’ с метилированными или неметилированными цитозиновыми основаниями (сайты 5’-GCNGC-3’ подчеркнуты):


NN01: 5’ GCTTGTACTTTAGCGGCATTGATTCTCACCACG 3’
NN02: 5’ CGTGGTGAGAATCAATGCCGCTAAAGTACAAGC 3’
NN1: 5’ GCTTGTACTTTAG(5mC)GGCATTGATTCTCACCACG 3’
NN2: 5’ CGTGGTGAGAATCAATG(5mC)CGCTAAAGTACAAGC 3’
DD1: 5’ GCTTGTACTTTAG(5mC)GG(5mC)ATTGATTCTCACCACG 3’
DD2: 5’ CGTGGTGAGAATCAATG(5mC)CG(5mC)TAAAGTACAAGC 3’
4mT: 5’ GGGAAAAG(5mC)TG(5mC)AAAAGAGGAAAGGG 3’
4mA: 5’ CCCTTTCCTCTTTTG(5mC)AG(5mC)TTTTCCC 3’



Как видно из рис.2, эндонуклеаза GluI расщепляет дуплексы DD1*/DD2 и 4mT*/4mA, содержащие полностью метилированную последовательность 5’-G(5mC)NG(5mC)-3’, но не расщепляет дуплекс NN01*/NN02, который содержит такую же неметилированную последовательность, а также дуплекс NN1*/NN2, который содержит метилированную последовательность 5’-G(5mC)NGC-3’. Полученные данные доказывают, что сайт-специфическая эндонуклеаза GluI расщепляет только метилированную ДНК, причем сайтом узнавания новой сайт-специфической эндонуклеазы GluI является метилированная последовательность 5'-G(5mC)NG(5mC)-3'.

b_320_200_16777215_00_Pics_paper24_fig2.jpg

 

 

Рис. 2. Расщепление олигонуклеотидных дуплексов NN01*/NN02 (a), NN1*/NN2 (b), DD1*/DD2 (c) и 4mT*/4mA (d) эндонуклеазами Fsp4HI (сайт узнавания 5’-GCNGC-3’, дорожка 2) и GluI (дорожка 3). Дорожка 1 – соответствующий дуплекс без гидролиза. Меченные олигонуклеотиды отмечены знаком *

 

 

 

b_320_200_16777215_00_Pics_paper24_fig3.jpg

 

 

Рис. 3. Определение места расщепления ДНК эндонуклеазой GluI. a – дуплекс DD1*/DD2, b – дуплекс DD2*/DD1
Дорожки: 1 – дуплекс без гидролиза, 2 – гидролиз эндонуклеазой GluI , 3 – гидролиз экзонуклеазой III, 4 – гидролиз эндонуклеазой BisI. Меченные олигонуклеотиды отмечены знаком *

 

 



На рисунке 3 приведены результаты гидролиза олигонуклеотидного дуплекса DD1/DD2 эндонуклеазами GluI и BisI. Сравнение длин фрагментов, образуемых при расщеплении этого субстрата, указывает на то, что GluI расщепляет метилированный дуплекс с четырьмя С5-метилцитозинами так же, как BisI. Следовательно, GluI расщепляет сайт узнавания как показано стрелками:


5' - G(5mC)↓N G (5mC) - 3'
3' - (5mC)G N↑(5mC)G - 5'


Таким образом, в настоящей работе мы описали новую сайт-специфическую эндонуклеазу GluI, принадлежащую к редкой группе ферментов, которые узнают и расщепляют только метилированную ДНК. Нуклеотидная последовательность, узнаваемая новым ферментом, и место гидролиза ДНК совпадают с таковыми для фермента BisI, однако GluI, в отличие от BisI, не активен на субстратах с двумя метильными группами и расщепляет ДНК, содержащую полностью метилированный сайт узнавания.
Гидролиз избыточно метилированной ДНК не является исключительным свойством нового фермента. В частности, ранее было показано, что эндонуклеаза GlaI, также являющаяся представителем группы ферментов подтипа IIM, проявляет максимальную активность на полностью метилированной узнаваемой последовательности 5'-G(5mC)↓G(5mC)-3'/3'-(5mC)G↓(5mC)G-5' [5].
Ранее обсуждалась возможная роль ферментов, которые узнают и расщепляют только метилированную ДНК, в защите бактерий от заражения фагами, ДНК которых метилирована [4]. В частности известно, что ряд бактериофагов содержит гены сайт-специфических ДНК-метилтрансфераз, что приводит к метилированию ДНК фагов [9]. Однако наличие такого свойства как предпочтительное расщепление избыточно метилированной ДНК свидетельствует в пользу существования каких-то других дополнительных функций данных ферментов в бактериальной клетке.
Мы полагаем, что GluI может найти применение для выявления и анализа метилированных участков ДНК эукариот, которые обычно содержат значительную долю 5-метилцитозиновых оснований. Как известно, метилирование ДНК играет значительную роль в регуляции клеточных процессов, но до сих пор остается недостаточно изученным [10].



Патент РФ № 2322492 C1

 

СПИСОК ЛИТЕРАТУРЫ

  1. Roberts R.J., Belfort M., Bestor, T., Bhagwat A.S., Bickle T.A. et al. // Nucleic Acids Res. – 2003. – V. 31. – P. 1805-1812.
  2. Lacks S. and Greenberg B.J. // Biol. Chem. - 1975. - V. 250. - P. 4060-4066.
  3. Чмуж Е.В., Каширина Ю.Г., Томилова Ю.Э., Мезенцева Н.В., Дедков В.С., Гончар Д.А., Абдурашитов М.А., Дегтярев С.Х. // Биотехнология. - 2005. - № 3. - С. 22-26. (интернет-версия)
  4. Чернухин В.А., Наякшина Т.Н., Абдурашитов М.А., Томилова Ю.Э., Мезенцева Н.В., Дедков В.С., Михненкова Н.А., Гончар Д.А., Дегтярев С.Х. // Биотехнология. - 2006. - № 4. - С. 23-28. (интернет-версия)
  5. Томилова Ю.Э., Чернухин В.А., Дегтярев С.Х. // Вестник биотехнологии и физико-химической биологии имени Ю.А.Овчинникова, - 2006 - т.2. - № 1. - C. 30-39. (интернет-версия)
  6. Чернухин В.А., Томилова Ю.Э., Чмуж Е.В., Соколова О.О., Дедков В.С., Дегтярев С.Х. // Вестник биотехнологии и физико-химической биологии имени Ю. А. Овчинникова. – 2007. – Т. 3 №1. – С. 28-33 - (интернет-версия)
  7. Чмуж Е.В., Каширина Ю.Г., Томилова Ю.Э., Чернухин В.А., Охапкина С.С., Гончар Д.А., Дедков В.С., Абдурашитов М.А., Дегтярев С.Х. // Молекулярная биология. – 2007. – Т. 41. – № 1. – С. 1-9.
  8. Чернухин В.А., Каширина Ю.Г., Суханова К.С., Абдурашитов М.А., Гончар Д.А., Дегтярев С.Х. // Биохимия – 2005. - т. 70. - № 6. - C.829-837.
  9. Lange C., Noyer-Weidner M., Trautner T.A., Weiner M., Zahler S.A. // Gene. - 1991. - V. 100. - P. 213-218.
  10. Costello J.F. and Plass C. // J. Med. Genet. - 2001. - V. 38. - P. 285-303.