MteI-ПЦР анализ – новый метод определения статуса метилирования GC-богатых регуляторных участков генов-онкосупрессоров человека

 

М.А. Абдурашитов, А.Н. Куксова, А.Г. Акишев, Е.В. Землянская, С.Х. Дегтярев

 

 

Предложен новый метод MteI-ПЦР-анализа GC-богатых участков ДНК, основанный на уникальной метилзависимой сайт-специфической ДНК-эндонуклеазе MteI, имеющей протяженный высокометилированный сайт узнавания. Метод включает гидролиз ДНК ферментом MteI с последующим проведением ПЦР либо в реальном времени, либо с определением полученных продуктов метод гель-электрофореза. Установлен статус метилирования регуляторных участков ряда генов-онкосупрессоров методом MteI-ПЦР-анализа в сравнении с ранее предложенным методом BlsI- и GlaI-ПЦР-анализа. Показана применимость метода MteI-ПЦР-анализа для анализа статуса метилирования регуляторных участков генов CEBPD, HS3ST2, RASSF1A, SEPT9b и TWIST1. В случае гена RASSF1A real-time MteI-ПЦР анализ, в отличие от real-time GlaI- и BlsI-ПЦР анализа, не показывает метилирования данного участка ДНК в контрольных здоровых клетках линии фибробластов легких. Таким образом, MteI-ПЦР анализ позволяет более четко определять и дискриминировать статус метилирования регуляторного участка гена RASSF1A и, вероятно, других GC-богатых участков ДНК человека.

 

Введение

За последние годы был открыт и охарактеризован целый ряд метилзависимых сайт-специфических ДНК-эндонуклеаз (МД-эндонуклеаз), расщепляющих короткие последовательности, содержащие 5-метилцитозин (5mC), и не гидролизуюшие неметилированную ДНК [1-8].  Такая специфичность делает МД-эндонуклеазы удобным инструментом для изучения метилирования участков ДНК высших эукариот, геномы которых содержат значительные количества 5mC [9-12].

Метилирование ДНК играет важную роль в регуляции генной активности эукариот. Регуляторные участки значительного числа генов высших организмов содержат так называемые CpG-островки, метилирование CG-пар внутри которых подавляет экспрессию этих генов [13-15]. Особый интерес исследователей вызывает модификация регуляторных областей генов-онкосупрессоров, так как она является основным эпигенетическим маркером при диагностике раковых заболеваний [16-18].

Ранее нами был описан простой метод определения статуса метилирования участков ДНК с помощью  МД-эндонуклеаз GlaI и BlsI – метод GlaI- и BlsI-ПЦР анализа [10,11]. Известно, что de novo метилирование ДНК в клетках млекопитающих и человека осуществляется ДНК-метилтрансферазами DNMT3a и DNMT3b, модифицирующими цитозин в обеих цепях сайта RCGY с образованием последовательности 5'-R(5mC)GY-3'/3'-YG(5mC)R-5' [19]. При этом, МД-эндонуклеаза GlaI узнает именно сайт 5'-R(5mC)GY-3'/3'-YG(5mC)R-5', что делает ее удобным инструментом для выявления метилированных de novo сайтов в ДНК. В свою очередь, BlsI расщепляет последовательность 5'-R(5mC)GYNR(5mC)GY-3'/3’-YG(5mC)RNYG(5mC)R-5', представляющую собой два метилированных сайта, разделенных одним нуклеотидом. Метод GlaI- и BlsI-ПЦР анализа [10] заключается в расщеплении геномной ДНК МД-эндонуклеазой с последующей амплификацией исследуемой области генома. При наличии в ней указанных метилированных участков они расщепляются ферментами GlaI и BlsI, соответственно, и их амплификации в ПЦР не происходит. Неметилированные участки ДНК после обработки МД-эндонуклеазами остаются интактными и амплификация с них проходит успешно.

Одной из наиболее интересных МД-эндонуклеаз является фермент MteI, который, в отличие от остальных ферментов этого типа, узнает протяженную и высокометилированую последовательность ДНК [7]. Такая уникальная субстратная специфичность может быть использована для определения статуса метилирования GC-богатых участков ДНК методом MteI-ПЦР анализа, заключающимся в  гидролизе исследуемой ДНК ферментом MteI и последующем ПЦР-анализе интересующего участка.

Целью настоящей работы явилось определение статуса метилирования GC-богатых участков регуляторных областей ряда генов-онкосупрессоров методом MteI-ПЦР анализа.

 

Материалы и методы

 

Гидролиз ДНК клеточных культур человека

В качестве субстратов для ПЦР использовались препараты ДНК, выделенной из одной контрольной немалигнантной клеточной линии L-68 (легочные фибробласты) и четырех малигнантных клеточных линий: Raji (лимфома Беркитта), U-937 (гистиоцитарная лимфома), HeLa (аденокарцинома шейки матки) и Jurkat (Т-лимфобластная лейкемия). Геномная ДНК из линий клеток человека, эндонуклеаза рестрикции HaeIII, метилзависимые сайт-специфические эндонуклеазы BlsI, GlaI и MteI, а также HotStart Taq-ДНК полимераза - производства компании СибЭнзим (Новосибирск, Россия).

0,1 мкг ДНК инкубировали в 30 мкл реакционной смеси, содержащей либо 100 ед. акт. HaeIII, либо 16 ед. акт. BlsI, либо 16 ед. акт. GlaI, в реакционном буфере, рекомендованном производителем, с добавлением 0,1 мкг/мкл BSA при температуре 37°C (для HaeIII) , 30°C (BlsI и GlaI) и 55°C (MteI) в течение 2 ч. После инкубации ферменты инактивировались путем прогрева (80°C для HaeIII и MteI, 65°C - в случае BlsI и GlaI) в течение 20 мин. 1 мкл реакционной смеси, содержащей 3,3 нг ДНК, использовали в ПЦР.

 

Проведение ПЦР

Для проведения ПЦР использовались праймеры, указанные в таблице 1.

 

Регуляторный участок гена

Хромосома

Координаты участка

по сборке GRCh37/hg19

Длина фрагмента, п.н.

Прямой и обратный праймеры

MGMT

10

131265230-131265585 

356

GGCGTGCCGGCGTCCAGCG

GGAGCGAGGCGACCCAGACACTCACC

RASSF2

20

4803816-4804239

424

GCGAGAGAAAAGAGAGGACAGCGGACGAGC

CAGCCGGGGTAGGGACCATCGTGGA

RARB

3

25469693-25470545

853

CCGGGTAGGGTTCACCGAAAGTTCACTCGC

TCAGCAAAGGGAATCAATATGCATGCCAGC

RASSF1A

3

50378209-50378593

385

CCGGATGTGGGGACCCTCTTCCTCTAGC

GCTCAATGAGCTCAGGCTCCCCCGAC

SFRP1

8

41166416-41167262

847

CCGCCCTGGTCTCTCTCC

GCCATGGTCTCGTGCTCC

CEBPD

8

48650692-48651032

341

CCTGGAGTGCTGGCAGAGGGAGTGTC

GGGCCGGGCTCTGCGTCCAA

CEBPD

8

48650593-48651032

440

CCTGGAGTGCTGGCAGAGGGAGTGTC

CGCCCGGCCCGGTTCGTAGAA

HS3ST2

16

22825348-22826048

701

GCTGTGTTTCTGGGAGGGGTA

GCACAGGAAGCTGTAACACAGGTA

TWIST1

7

19156756-19157957

1202

CGAGAGAGCAGGCCGGGACGCAA

GCCGCCTCCGACGCCCCCA

RASSF1A

3

50377790-50378239

450

CTGTGGCCCAGATACGAGTGGAGTGCGAC

GCCATGTCGGGGGAGCCTGAGCTCA

SEPT9b (1)

17

75369017-75369448

432

CTGCCCAAATACAGCCTCCTGCAGAAGG

CCCTAGGCCCCCTGGCTCAGCTG

SEPT9b (2)

17

75369405-75369601

197

CGCCTTCCTCCCCCATTCATTCAGCTG

CGTTGACCGCGGGGTCCGACATG

SEPT9b (3)

17

75369557-75369955

399

CGACCCGCTGCCCACCAGCCATC

CGAGGAGGTCGCTGTCGCTTGGCA

 Таблица 1. Структура праймеров и амплифицируемые участки генома человека.

Реакции амплификации проводили в 20 мкл реакционной смеси следующего состава: 1x буфер AS, 1х стабилизатор, 0,2 mM каждого dNTP, 2 mM MgCl2, 0,4 mkM каждого праймера, 4% DMSO (в случае регуляторного участка гена RARB DMSO не добавляли), 0,8 ед.акт. HotStart Taq-ДНК полимеразы, 3,3 нг гидролизованной или не гидролизованной геномной ДНК. Все перечисленные компоненты реакционной смеси - производства компании СибЭнзим (Новосибирск, Россия).

ПЦР проводили в приборе C1000 Thermal Cycler (BioRad, США). Проводили предварительный прогрев 3 мин при 95°C, затем 38 циклов амплификации: плавление - 96°C, 20 сек; отжиг - при температуре на 3-5°C меньшей, чем температура плавления праймеров, 20 сек; элонгация - 72°C  в течение 20-70 сек (в зависимости от длины амплифицируемого фрагмента).

Для проведения ПЦР в реальном времени использовались праймеры и зонды, указанные в таблице 2.

 

Регуляторный участок гена

Хромосома

Координаты участка

по сборке GRCh37/hg19

Длина фрагмента, п.н.

Прямой, обратный праймеры и флюоресцентно меченный зонд

RASSF1A

3

50378020-50378236

217

ATGTCGGGGGAGCCTGAG

AGATGAAGTCGCCACAGAGGTC

FAM-TGCCAGCTCCCGCAGCTCAAT-BHQ1

SEPT9b

17

75369721-75369840

120

GGGAGACGGGAGTGCGCTGAGG

GCCCCTAACAGGGTCCCCCACGTAG

FAM-CCCTCCCGCTGAGAGCGCCG-BHQ1

Таблица 2. Структура праймеров и зондов для амплифицируемых участков генома человека в режиме реального времени.

ПЦР в реальном времени проводили в приборе CFX96 Real-Time System (BioRad, США). Реакция с каждой матричной ДНК (гидролизованной или негидролизованной) проводилась в трех повторах. Использовалась программа амплификации: предварительный прогрев при 95°C в течение 5 мин, затем 45 циклов амплификации: плавление - 95°C, 10 сек; отжиг - 61°C, 30 сек и элонгация - 72°C, 20 сек. Анализ данных и их обработка осуществлялись с помощью программ Bio-Rad CFX Manager v.2.1  и Microsoft Excel 2010.

 

Результаты и обсуждение

В таблице 1 представлен список регуляторных областей девяти генов-онкосупрессоров, статус метилирования которых определялся методом GlaI- и BlsI-ПЦР анализа, а также методом MteI-ПЦР анализа, включающим гидролиз ДНК ферментом MteI с последующей амплификацией исследуемой области генома. В таблице указаны хромосомная локализация и координаты исследуемых участков ДНК, представлена структура использованных праймеров и приведены длины получаемых ампликонов. В случае гена CEBPD изучались короткий и расширенный варианты регуляторной области, в случае гена SEPT9b определялся статус метилирования 3-х отдельных участков регуляторной области, а в случае гена RASSF1A – двух отдельных участков.

В качестве субстрата мы использовали ДНК клеточных линий L-68 и Raji, которые расщеплялись МД-эндонуклеазами GlaI, BlsI и MteI. Выбор данных клеточных линий  обусловлен тем, что ДНК из клеток L-68, как правило, не содержит метилированных цитозиновых остатков в  регуляторных участках ранее изучавшихся нами генов-онкосупрессоров, в то время как ДНК из клеток Raji, напротив, в подавляющем большинстве случаев метилирована в этих областях [11]. Как положительный и отрицательный контроль, т.е., наличие или отсутствие расщепления ДНК, мы использовали HaeIII-гидролизаты ДНК и исходную ДНК, соответственно. Амплификацию полученных гидролизатов и контрольной ДНК проводили как описано в методах.

На рисунке 1 представлены электрофореграммы, полученные после разделения в геле фрагментов ДНК, амплифицированных с выбранных регуляторных участков геномной ДНК, гидролизованной различными эндонуклеазами.

 

b_320_200_16777215_00_Pics_paper82-fig1.jpg

 

 

 

Рисунок 1. Результаты GlaI-, BlsI- и MteI-ПЦР  анализа регуляторных участков генов-онкосупрессоров. Обозначения дорожек: гидролизаты H - HaeIII, G - GlaI, B - BlsI, M - MteI; К - ДНК без обработки эндонуклеазой; L - маркер длин фрагментов 100 bp (СибЭнзим). 

 

 

 

Как видно из рисунка, МД-эндонуклеазы гидролизуют большую часть анализируемых участков в ДНК клеточной линии Raji, в то время как контрольная ДНК L-68 ими не расщепляется. Данные по гидролизу ДНК Raji сведены в Таблицу 3. В таблице также представлено количество сайтов RCGY, RCGYNRCGY и GCGCNGCGC, расположенных в изучаемых участках. В случае метилирования DNMT3a или DNMT3b первые две последовательности становятся сайтами узнавания GlaI и BlsI, соответственно. Сайт GCGCNGCGC является минимальным сайтом узнавания MteI при наличии в нем 6-ти 5-метилцитозинов [7]. 

 

 

Регуляторный участок гена (длина ПЦР-продукта)

Количество сайтов  узнавания / результат гидролиза ферментом

Структура сайтов NNGCGCNGCGCNN в изучаемом регуляторном участке и число цитозинов, метилируемых DNMT3

RCGY/GlaI гидролиз

RCGYNRCGY/BlsI гидролиз

GCGCNGCGC/MteI гидролиз

MGMT  (356 п.н.)

   16/-

   -/-

    -/-

-

RASSF2 (424 п.н.)

   13/-

   -/-

    -/-

-

RARB  (853 п.н.)

    4/+

   -/-

    -/-

-

RASSF1A (385 п.н.)

    7/+

   -/-

    -/-

-

SFRP1 (847 п.н.)

   28/+

    1/+

    1/(-/+)

5’-GGGCGCGGCGCTT-3’ (4)

3’-CCCGCGCCGCGAA-5’

CEBPD (341 п.н.)

   11/+

    1/+

    1/(-/+)

5’-CAGCGCAGCGCAG-3’ (4)

3’-GTCGCGTCGCGTC-5’

CEBPD (440 п.н.)

   19/+

    3/+

    3/+

5’-CAGCGCAGCGCAG-3’ (4)

3’-GTCGCGTCGCGTC-5’

 

5’-GAGCGCCGCGCTC-3’ (4)

3’-CTCGCGGCGCGAG-5’

 

5’-GCGCGCGGCGCGC-3’ (8)

3’-CGCGCGCCGCGCG-5’

HS3ST2 (701 п.н.)

   29/+

     2/+

     1/+

5’-GGGCGCGGCGCGG-3’ (4)

3’-CCCGCGCCGCGCC-5’

TWIST (1202 п.н.)

   28/+

     2/+

     2/+

5’-CGGCGCCGCGCGC-3’ (6)

3’-GCCGCGGCGCGCG-5’

 

5’-AGGCGCAGCGCGG-3’ (4)

3’-TCCGCGTCGCGCC-5’

RASSF1A (450 п.н.)

    19/+

      1/+

      1/+

5’-ACGCGCTGCGCAT-3’ (6)

3’-TGCGCGACGCGTA-5’

SEPT9b (1-432 п.н.)

    10/+

      1/+

      1/+

5’-GGGCGCAGCGCGC-3’ (6)

3’-CCCGCGTCGCGCG-5’

SEPT9b (2–197 п.н)

     7/+

       1/+

      1/(-/+)

5’-GGGCGCGGCGCCC-3’ (4)

3’-CCCGCGCCGCGGG-5’

SEPT9b (3-399 п.н.)

     16/+

       1/+

      1/+

5’-GAGCGCCGCGCGC-3’ (6)

3’-CTCGCGGCGCGCG-5’

Таблица 3. Результаты определения статуса метилирования регуляторных участков генов-онкосупрессоров в ДНК клеточной линии Raji методом GlaI-, BlsI- и MteI-ПЦР  анализа.           

Последовательность GCGCNGCGC подчеркнута. Серым цветом выделены цитозины, метилируемые ферментами DNMT3a или DNMT3b. 

Как видно из рисунка 1 и таблицы 3 в случае регуляторных участков генов MGMT и RASSF2 наблюдается образование соответствующих ПЦР-продуктов после гидролиза ДНК ферментами GlaI, BlsI и MteI, что соответствует отсутствию метилирования по сайтам RCGY. Для регуляторного участка гена MGMT отсутствие метилирования в ДНК  клеточной линии Raji было показано ранее [11]. Регуляторные участки генов RARB и RASSF1A в ДНК  Raji расщепляются лишь GlaI, а BlsI и MteI не гидролизуют ДНК на этих участках в связи с отсутствием соответствующих сайтов узнавания на данных участках. Регуляторный участок гена SFRP1, короткий фрагмент регуляторного участка гена CEBPD (341 п.н.) и второй участок регуляторной области гена SEPT9b (197 п.н.) расщепляется ферментами GlaI и BlsI, однако гидролиз этих фрагментов МД-эндонуклеазой MteI затруднен. Как нетрудно видеть, в структуре сайтов узнавания MteI, находящихся в этих участках, присутствует только 4 цитозина, метилируемых DNMT3a и DNMT3b, что недостаточно для полного гидролиза ферментом указанных метилированных сайтов. В более длинном фрагменте регуляторного участка гена CEBPD (440 п.н.) присутствует три сайта NGCGCNGCGCN, один из которых содержит 8 метилируемых цитозинов и такой метилированный сайт является хорошим субстратом MteI [7]. Один из сайтов NGCGCNGCGCN в регуляторном участке гена TWIST содержит 6 метилируемых цитозинов и такой метилированный сайт также полностью расщепляется всеми тремя МД-эндонуклеазами. Ситуация, аналогичная гену TWIST, наблюдается в случае регуляторного участка гена RASSF1A (450 п.н.), а также первого и третьего участков регуляторной области гена SEPT9b (432 п.н и 399 п.н., соответственно), которые полностью расщепляются MteI. Анализ первичной структуры регуляторной области гена HS3ST2 выявил только один сайт NGCGCNGCGCN, который содержит всего 4 метилируемых цитозина и вследствие этого является плохим субстратом MteI. Однако, эксперимент (рис.1) показал, что данный фрагмент ДНК полностью расщепляется MteI. Дальнейшие исследования по установлению первичной структуры регуляторной области гена HS3ST2 в клетках Raji и прямое определение «узора» метилирования в сайте NGCGCNGCGCN должно выявить последовательность ДНК, гидролизуемую ферментом MteI/

Полученные результаты показывают, что MteI-ПЦР анализ позволяет определить статус метилирования регуляторных участков генов-онкосупрессоров, содержащих в последовательности NGCGCNGCGCN шесть и более 5-метилцитозинов и может быть использован при анализе гиперметилированных участков ДНК.

Ранее нами было предложено использовать GlaI- и BlsI-ПЦР анализ для идентификации малигнантных клеточных линий человека, так как они отличаются по статусу метилирования регуляторных участков известных генов-онкосупрессоров [11]. При лабораторном культивировании часто происходит загрязнение клеточных линий другими клетками и "вырождение" культур клеток, приводящее к утрате нужной линии или ее исходных свойств.  Заранее определенный профиль метилирования ряда участков ДНК может служить эпигенетической характеристикой линии клеток. Для этой цели, наряду с GlaI- и BlsI-ПЦР анализом, может быть использован MteI-ПЦР анализ.          С помощью MteI-ПЦР анализа мы провели определение статуса метилирования сайта NGCGCNGCGCN в регуляторных участков генов RASSF1A и SEPT9b (таблица 3) для ДНК из четырех малигнантных клеточных линий Raji, U-937, HeLa и Jurkat, а также из контрольных клеток L-68. Координаты амплифицируемых участков в геноме, длины ПЦР-продуктов и структуры использовавшихся праймеров приведены в таблице 1.

Полученные результаты представлены на рисунке 2.

 

 

b_320_200_16777215_00_Pics_paper82-fig2.jpg

 

Рисунок 2.  ПЦР-продукты, образующиеся при амплификации частей регуляторных участков генов-онкосупрессоров после обработки эндонуклеазами. Обозначения дорожек - как на рисунке 1.

 

 

Как видно из рисунка 2, GlaI-, BlsI- и MteI-ПЦР анализ дают одинаковые результаты при определении статуса метилирования регуляторных участков генов RASSF1A и SEPT9b (3). Исследуемые районы этих двух генов расщепляются ферментами GlaI, BlsI и MteI в ДНК клеток Raji, и не гидролизуются в ДНК контрольной клеточной линии L-68. В то же время GlaI-, BlsI- и MteI-ПЦР анализ гена RASSF1A дал положительный результат в ДНК клеточной линии Jurkat, тогда как в случае гена SEPT9b(3) гидролиз ДНК происходит в клеточных линиях U-937 и HeLa и не происходит в клетках Jurkat. Полученные результаты соответствуют ранее опубликованным данным [11]. Таким образом, MteI-ПЦР анализ, наряду с GlaI- и BlsI-ПЦР анализом, может также использоваться для типирования малигнантных клеточных линий.

В последнее время метод real-time ПЦР все шире применяется как в научных исследованиях, так и в клинической работе, вытесняя метод электрофоретического анализа ПЦР-продуктов из повседневной практики. В связи с этим, мы также провели real-time GlaI-, BlsI- и MteI-ПЦР анализ регуляторных участков генов RASSF1A и SEPT9b (3). Структуры использовавшихся праймеров  и флюоресцентно меченных зондов и координаты амплифицируемых участков приведены в таблице 2. Полученные данные после статистической обработки были использованы для построения диаграмм, показывающих степень гидролиза различных амплифицируемых участков. Результаты real-time GlaI-, BlsI- и MteI-ПЦР анализа представлены на рисунке 3. Полученные данные достаточно хорошо согласуются с результатами электрофоретического анализа, описанными выше (рис. 2). Как видно из рис. 3, гидролиз указанных фрагментов ДНК Raji всеми тремя ферментами происходит практически полностью. Однако, если MteI практически не расщепляет сайт NGCGCNGCGCN в исследуемых фрагментах ДНК контрольной клеточной линии L-68, то GlaI и BlsI гидролизуют регуляторный участок гена RASSF1A в ДНК L-68 на 20% и 15%, соответственно, что говорит о частичном метилировании сайтов RCGY в этом участке в ДНК контрольной линии фибробластов.

Таким образом, в случае гена RASSF1A real-time MteI-ПЦР анализ, в отличие от real-time GlaI- и BlsI-ПЦР анализа, не показывает метилирования данного участка ДНК в контрольных здоровых клетках линии фибробластов легких. MteI-ПЦР анализ позволяет более четко определять и дискриминировать статус метилирования регуляторного участка гена RASSF1A и, вероятно, других GC-богатых участков ДНК человека.

 

 

b_320_200_16777215_00_Pics_paper82-fig3.JPG

 

 

Рис. 3. Степень гидролиза коротких участков ДНК по данным ПЦР в реальном времени.

По оси ординат показан процент гидролизованных участков.

 

 

 

 

 

Авторы выражают благодарность Чернухину В.А. и Гончару Д.А. за консультации и помощь.

 

 

Литература

  1. Чмуж Е.В., Каширина Ю.Г., Томилова Ю.Э., Мезенцева Н.В., Дедков В.С., Гончар Д.А., Абдурашитов М.А., Дегтярев С.Х. Новая эндонуклеаза рестрикции BisI из Bacillus subtilis Т30 узнает метилированную последова­тельность ДНК 5’G(m5C)^NGC-3’ // Биотехнология. – 2005. – № 3. – С. 22–26.
  2. Чернухин В.А., Наякшина Т.Н., Абдурашитов М.А., Томилова Ю.Э., Мезенцева Н.В., Дедков В.С., Михненкова Н.А., Гончар Д.А., Дегтярев С.Х. Новая эндонуклеаза рестрикции GlaI узнает метилированную последовательность 5’G(m5C)^GC-3’ // Биотехнология. – 2006. – № 4. – С. 23–28.
  3. Чернухин В.А., Томилова Ю.Э., Чмуж Е.В., Соколова О.О., Дедков В.С., Дегтярев С.Х. Сайт-специфическая эндонуклеаза BlsI узнает последовательность ДНК 5’-G(5mC)N^GC-3’ и расщепляет ее с образованием 3’-выступающих концов // Вестник биотехнологии и физико-химической биологии имени Ю.А.Овчинникова. – 2007. – Т. 3. – № 1. – С. 28–33.
  4. Чернухин В.А., Чмуж Е.В., Томилова Ю.Э., Наякшина Т.Н., Гончар Д.А., Дедков В.С., Дегтярев С.Х. Новая сайт-специфическая эндонклеаза GluI узнаёт метилированную последовательность ДНК 5’-G(5mC)NG(5mC)-3’/3’-(5mC)GN(5mC)G-5’ // Вестник биотехнологии и физико-химической биологии имени Ю.А. Овчинникова. – 2007. – Т. 3. – № 2. – С. 13–17.
  5. Чернухин В.А., Килева Е.В., Томилова Ю.Э., Болтенгаген А.А., Дедков В.С., Михненкова Н.А., Гончар Д.А., Голикова Л.Н., Дегтярев С.Х. Новая метил-зависимая сайт-специфическая эндонуклеаза KroI узнает и расщепляет последовательность ДНК 5`-G^C(5mC)GGC-3` // Вестник биотехнологии и физико-химической биологии имени Ю.А. Овчинникова. – 2011. – Т. 7. – № 1. – С. 14–20.
  6. Чернухин В.А., Наякшина Т.Н., Гончар Д.А., Томилова Ю.Э., Тарасова М.В., Михненкова Н.А., Дедков В.С., Дегтярев С.Х. Новая сайт-специфическая метилзависимая ДНК-эндонуклеаза PkrI узнаёт и расщепляет метилированную последовательность ДНК 5’-GCN^GC-3’/3’-CG^NCG-5’, содержащую не менее трёх 5-метилцитозинов // Вестник биотехнологии и  физико-химической биологии имени Ю.А. Овчинникова. – 2011. – Т. 7. – № 3. – С. 35–41.
  7. Чернухин В.А., Гончар Д.А., Килева Е.В., Соколова В.А., Голикова Л.Н., Дедков В.С., Михненкова Н.А., Дегтярев С.Х. Новая метилзависимая сайт-специфическая ДНК-эндонуклеаза MteI расщепляет девятинуклеотидную последовательность 5`-G(5mC)G(5mC)NG(5mC)GC-3`/3`-CG(5mC)GN(5mC)G(5mC)G-5` // Вестник биотехнологии и физико-химической биологии имени Ю.А. Овчинникова. – 2012. – Т. 8. – № 1. – С. 16–26.
  8. Zheng Y., Cohen-Karni D., Xu D., Chin H.G., Wilson G., Pradhan S., Roberts R.J. A unique family of Mrr-like modification-dependent restriction endonucleases // Nucleic Acids Res. – 2010. – Vol. 38. – P. 5527–5534.
  9. Abdurashitov M.A., Chernukhin V.A, Gonchar D.A., Degtyarev S.Kh. GlaI digestion of mouse γ-satellite DNA: study of primary structure and ACGT sites methylation // BMC Genomics. – 2009. – Vol. 10. – P. 322.
  10. Гончар Д.А., Акишев А.Г., Дегтярев С.Х. BlsI- и GlaI-ПЦР анализ – новый метод исследования метилированных участков ДНК // Вестник биотехнологии и физико-химической биологии имени Ю.А. Овчинникова. – 2010. – Т. 6. – № 1. – С. 5–12.
  11. Акишев А.Г., Гончар Д.А., Абдурашитов М.А., Дегтярев С.Х. Эпигенетическое типирование малигнантных клеточных линий человека с помощью BlsI- и GlaI-ПЦР анализа // Вестник биотехнологии и физико-химической биологии имени Ю.А. Овчинникова. – 2011. – Т. 7. – № 3. – С. 5–16.
  12. Rand K.N., Young G.P., Ho T., Molloy P.L. Sensitive and selective amplification of methylated DNA sequences using helper-dependent chain reaction in combination with a methylation-dependent restriction enzymes // Nucleic Acids Res. – 2013. – Vol. 41(1). – e15.
  13. Illingworth R.S., Bird A.P. CpG islands – 'A rough guide' // FEBS Lett. – 2009. – Vol. 583. – № 11. – P. 1713–1720.
  14. Blackledge N.P., Klose R.J. CpG island chromatin: A platform for gene regulation // Epigenetics. – 2011. – Vol. 6. – № 2. – P. 147–152.
  15. Deaton A.M., Bird A. CpG islands and the regulation of transcription // Genes Dev. – 2011. – Vol. 25. – № 10. – P. 1010–1022.
  16. Sproul D., Meehan R.R. Genomic insights into cancer-associated aberrant CpG island hypermethylation // Brief Funct Genomics. – 2013. – Vol. 12. – № 3. – P. 174–190.
  17. Mikeska T., Bock C., Do H., Dobrovic A. DNA methylation biomarkers in cancer: progress towards clinical implementation // Expert Rev Mol Diagn. – 2012. – Vol. 12. – № 5. – P. 473–487.
  18. Jain S., Wojdacz T.K., Su Y.H. Challenges for the application of DNA methylation biomarkers in molecular diagnostic testing for cancer // Expert Rev Mol Diagn. – 2013. – Vol. 13. – № 3. – P. 283–294.
  19. Handa V., Jeltsch A. Profound sequence preference of Dnmt3a and Dnmt3b mammalian DNA methyltransferases shape the human epigenome. // J. Mol. Biol. – 2005. – Vol. 348 – P.1103-1112.
  20. Cohen-Karni D., Xu D., Apone L., Fomenkov A., Sun Z.Y., Davis P.J., Kinney S.R.M., Yamada-Mabuchi M., Xu S.Y., Davis T., Pradhan S., Roberts R.J., Zheng Y. The MspJI family of modification-dependent restriction endonucleases for epigenetic studies // Proc Natl Acad Sci. – 2011. – Vol. 108. – P. 11040–11045.