Применение метода GLAD-ПЦР анализа для выявления сайтов метилирования в регуляторных областях генов-онкосупрессоров ELMO1 и ESR1 при колоректальном раке

А.А.Евдокимов, Н.А.Нетесова, Н.А.Сметанникова, М.А.Абдурашитов, А.Г.Акишев,  Е.С.Давидович, В.В. Кузнецов, Ю.Д.Ермолаев, А.Б.Карпов, А.Э.Сазонов, Р.М.Тахауов, С.Х.Дегтярев
Вопросы онкологии, №1, 2016, стр. 116-120

Аберрантное метилирование регуляторных областей генов-онкосупрессоров показано для многих онкологических заболеваний. В данной работе разработанный нами ранее метод GLAD-ПЦР анализа [3] был применен для выявления сайтов R(5mC)GY, возникающих при аберрантном метилировании регуляторных областей генов ELMO1 и ESR1 в препаратах ДНК клеточной линии SW837 и тканей опухоли толстой кишки. Были отобраны по 4 сайта для каждого гена и установлено, что в ДНК SW837 наиболее метилированными являются сайт GCGC в первом экзонe гена ELMO1 и сайт GCGT в промоторе гена ESR1. Сайт GCGT в промоторе гена ESR1 слабо метилирован в здоровых тканях и более метилирован в большинстве опухолевых тканей. Сайт GCGC в первом экзонe гена ELMO1 неметилирован в ДНК здоровых тканей и метилирован в 60% образцов опухолевых ДНК. Обсуждаются возможности применения метода GLAD-ПЦР анализа препаратов внеклеточной ДНК крови пациентов для диагностики колоректального рака.

 

Метилирование ДНК играет важную роль в развитии онкологических заболеваний. Известно, что на ранних стадиях канцерогенеза происходит метилирование de novo регуляторных областей ряда генов, что приводит к выключению их экспрессии, тогда как в здоровой ткани данные области неметилированы и соответствующие гены активны [6]. Такое ненормальное (аберрантное) метилирование было показано для целого ряда генов-онкосупрессоров в опухолевых тканях [2, 6]. Аберрантное метилирование описано для нескольких десятков генов-онкосупрессоров, причем этот набор генов отличается в различных опухолях [11]. В частности, для колоректального рака в целом ряде публикаций показано наличие аберратного метилирования более 50 генов [8, 9, 12].

У млекопитающих метилирование ДНК de novo, включая и аберрантное метилирование, осуществляют ДНК-метилтрансферазы Dnmt3a и Dnmt3b, которые узнают сайт 5’-RCGY-3’ и модифицируют внутренний CG-динуклеотид с образованием последовательности 5’-R(5mC)GY-3’ в обеих цепях ДНК [7], где R – A или G, Y – T или C, 5mC – 5-метилцитозин. В дальнейшем метилирование вновь образованных модифицированных сайтов поддерживается в ходе репликации ДНК с помощью ДНК-метилтрансферазы Dnmt1. Недавно обнаруженная метилзависимая сайт-специфическая ДНК-эндонуклеаза GlaI узнает и расщепляет как указано стрелкой именно сайт R(5mC)¯GY [13], что делает ее удобным инструментом для выявления метилированных de novo сайтов в ДНК человека. Ранее на основе фермента GlaI нами был разработан метод GLAD-ПЦР анализа, позволяющий выявлять наличие молекул ДНК с сайтом R(5mC)GY в заданном положении генома человека даже в условиях избытка других молекул ДНК, где этот сайт неметилирован [3].

Колоректальный рак является достаточно хорошо изученным онкозаболеванием и для него показано аберрантное метилирование целого ряда генов-онкосупрессоров [5, 15].

Целью данной работы явилось изучение возможности использования GLAD-ПЦР анализа для определения аберрантного метилирования сайтов R(5mC)GY в регуляторных областях генов ELMO1 и ESR1 в препаратах ДНК из опухолевых тканей при колоректальном раке.

МАТЕРИАЛЫ И МЕТОДЫ

Материалом для исследования являлась панель образцов ДНК, выделенных из тканей опухолей толстой кишки и здоровых тканей больных колоректальным раком и, в качестве положительного контроля, ДНК линии клеток аденокарциномы ободочной кишки человека линии SW837. Во всех случаях злокачественного новообразования диагноз был подтвержден морфологически (аденокарцинома различной степени дифференцировки). По стадии заболевания больные распределялись следующим образом: 2 больных (номера пациентов 1 и 76) имели I стадию заболевания (T1N0M0), 3 пациента (номера 16, 20 и 37) – II стадию (T2N0M0), 6 больных  (номера пациентов 2, 19, 31, 50, 54 и 56) – III стадию (T1-4N1-2M0) и у 4 больных был диагностирован генерализованный колоректальный рак (наличие отдалённых метастазов (М1 при любых вариантах размера опухоли (T) и наличия или отсутствия метастатического поражения регионарных лимфатических узлов (N)) (пациенты номер 25, 51, 59 и 75). У всех доноров биологического материала было получено информированное согласие на участие в исследовании.

Образцы ткани опухолей (n=15), полученные при выполнении оперативного вмешательства помещались в пробирку, содержащую раствор RNA-later и хранились в течение суток в холодильнике при температуре +4°С, затем переносились в морозильную камеру и хранились при температуре –20°С. В качестве отрицательных контрольных образцов использовались фрагменты здоровой ткани толстой кишки (n=5), которые брались на значительном удалении от опухолевого очага – на линии резекции. Процедура консервации и хранения образцов здоровой ткани была аналогична описанной, применительно к опухолевой ткани.

Выделение ДНК. Выделение и очистку ДНК из опухолевых и здоровых тканей, а также ДНК клеток аденокарциномы ободочной кишки человека линии SW837, использованной для выявления перспективных для GLAD-ПЦР анализа сайтов R(5mC)GY, проводили методом фенол-хлороформной экстракции [4]. Концентрации полученных препаратов ДНК оценивали используя спектрофотометр «NanoVue Plus» (GE Healthcare, Великобритания). Дополнительную нормализацию препаратов ДНК проводили при помощи ПЦР в режиме реального времени, отдельно по каждому из изучаемых генов с использованием ген-специфичных праймеров и зондов. Для этого готовили стандартные разведения референсной ДНК, в качестве которой использовали лейкоцитарную ДНК здорового донора, полученную и очищенную как описано ранее [1]. Условия реакции были идентичны описанным ниже для ПЦР-стадии GLAD-ПЦР анализа.

GLAD-ПЦР анализ включает три стадии [3]. Сначала ферментом GlaI расщепляются по центру все имеющиеся в ДНК сайты R(5mC)GY с образованием тупых концов. Затем полученные фрагменты при помощи ДНК лигазы фланкируются олигонуклеотидным адаптером. На третьей стадии ставится ПЦР с праймера, комплементарного изучаемому фрагменту ДНК, и второго (так называемого гибридного) праймера, комплементарного адаптеру и следующим нескольким нуклеотидам геномной последовательности в точке расщепления целевого сайта. В результате при наличии огромного количества разных фрагментов, полученных после гидролиза ДНК и последующей сшивки, ПЦР идет преимущественно с того фрагмента, который расположен рядом с целевым сайтом R(5mC)GY. Использование зонда, также имеющего уникальную структуру, позволяет еще больше повысить специфичность реакции.

В настоящей работе GLAD-ПЦР анализ препаратов ДНК проводили, в основном, как описано ранее [3], за исключением следующих изменений: 1) объединение стадий GlaI-гидролиза и лигирования ДНК в одну совмещенную реакцию; 2) замена прежнего адаптера [3] на более эффективный. Данные изменения позволили сократить время анализа и повысить его чувствительность.

В работе использовали метилзависимую эндонуклеазу рестрикции GlaI, ДНК-лигазу фага T4, Hot Start Taq ДНК-полимеразу, дНТФ, 10х GlaI буфер (0,1 М Tris-HCl, pH 8,5, 0,1 М NaCl, 50 мМ MgCl2, 10 мМ ß-меркаптоэтанол), 10х GLAD-ПЦР буфер (0,5 М Tris-SO4, pH 9,0, 0,1 М [NH4]2SO4, 0,3 М KCl, 0,1% Твин 20, 30 мМ MgCl2) и 5х стабилизатор для амплификации GC-богатых участков ДНК (2,7 М бетаин, 6,7 мМ ДТТ, 6,7% ДМСО) производства «СибЭнзайм» (Новосибирск, Россия).

Реакционная смесь для совместного гидролиза и лигирования ДНК содержала 1х GlaI буфер (10 мМ Tris-HCl, pH 8,5, 10 мМ NaCl, 5 мМ MgCl2, 1 мМ ß-меркаптоэтанол), 100 нг/мкл БСА, 6 мМ ß-меркаптоэтанола (дополнительно к содержащемуся в буфере), 0,5 мМ АТФ, 0,04 е.а./мкл метилзависимой эндонуклеазы рестрикции GlaI (СибЭнзайм, Россия), 33 е.а./мкл T4 ДНК-лигазы и по 0,5 мкМ олигонуклеотидов 5’-CCTGCTCTTTCATCG-3’ и 3’-p-GGACGAGAAAGTAGC-p-5’ (составляющих 15-звенный адаптерный дуплекс, содержащий 3’- и 5’-фосфаты в одной из цепей). В реакцию брали количество образца ДНК, соответствующее 103 копий анализируемого гена. Конечный объем реакционной смеси составлял 30 мкл. Реакцию проводили в течение 60 мин при 25°С с последующей инактивацией ферментов при 65°С в течение 20 мин.

Далее к полученной лигазной смеси добавляли следующие компоненты до достижения итоговых концентраций в конечном объеме, равном 60 мкл: 1x GLAD-ПЦР буфер (50 мМ Tris-SO4, pH 9,0, 10 мМ [NH4]2SO4, 30 мМ KCl, 0,01% Твин 20, 3 мМ MgCl2), 1x стабилизатор (0,54 М бетаин, 1,34 мМ ДТТ, 1,34% ДМСО), по 0,2 мМ каждого дНТФ, по 0,4 мкМ геномного праймера, гибридного праймера и зонда, и 0,05 е.а./мкл Hot Start ДНК-полимеразы. Реакцию ПЦР проводили в объеме по 20 мкл на детектирующем амплификаторе «CXF-96» (Bio-Rad Laboratories, США) по унифицированной программе: прогрев 95°С 3 мин, далее 5 циклов без детекции: 95°С 10 сек, 61°С 15 сек, 72°С 20 сек; затем 50 циклов с детекцией (канал FAM) на стадии отжига: 95°С 10 сек, 61°С 15 сек, 72°С 20 сек.

Для анализаиспользовали следующие праймеры и зонды:

ELMO1g             GGGTCGCCGGAGCTCTGA;
ELMO1z              FAM-AACCCTTGCCGCTGCTGTCCTGC-BHQ1;
ELMO1h1           CCTGCTCTTTCATCGGСCA;  
ELMO1h2           CCTGCTCTTTCATCGGСGG;
ELMO1h3           CCTGCTCTTTCATCGGСCG;  
ELMO1h4           CCTGCTCTTTCATCGGCCT;

ESR1g                  CGCAGGGCAGAAGGCTCAGAA;
ESR1z                   FAM-TGCTCTTTTTCCAGGTGGCCCGCC-BHQ1;
ESR1h1                CCTGCTCTTTCATCGGTCG;  
ESR1h2                CCTGCTCTTTCATCGGСTG;
ESR1h3                CCTGCTCTTTCATCGGTGT;  
ESR1h4                CCTGCTCTTTCATCGGTTC,

где g – геномный праймер; z – флуоресцентно-меченный зонд; h1, h2, h3 h4 – гибридные праймеры.

Анализ данных и их статистическая обработка осуществлялись с помощью программного обеспечения амплификатора «Bio-Rad CFX Manager v.2.1» (Bio-Rad Laboratories, США).

Описание исследуемых фрагментов ДНК. На рисунке 1 представлены координаты регуляторных участков генов ELMO1 и ESR1, выбранных для исследования. В случае гена ELMO1 изучаемый участок представляет собой фрагмент CpG-островка в районе первого экзона длиной 154 нуклеотида, тогда как в гене ESR1 мы определяли метилирование сайтов RCGY в участке CpG-островка длиной 183 нуклеотида в промоторной области. Как представлено на рисунке, исследуемые участки содержат по 4 сайта RCGY, которые могут подвергаться модификации в случае аберрантного метилирования и расщепляться затем ферментом GlaI.

 

(А)
b_320_200_16777215_00_images_stories_esr1elmo1_1a.jpg
(В)
b_320_200_16777215_00_images_stories_esr1elmo1_1c.jpg
(Б)
b_320_200_16777215_00_images_stories_esr1elmo1_1b.jpg
(Г)
b_320_200_16777215_00_images_stories_esr1elmo1_1d.jpg

Рис.1 Определение сайтов R(5mC)GY в ДНК клеточной линии SW837.
(а) – фрагмент нуклеотидной последовательности регуляторной области гена ELMO1. Показаны сайты RCGY, участки связывания геномного праймера, зонда и 3’-концевого тетрануклеотида в гибридных праймерах. (б) – кривые накопления флуоресценции в ходе ПЦР в режиме реального времени с использованием различных гибридных праймеров. Заглавными буквами “GCCG” на рисунках обозначен 3’-концевой тетрануклеотид гибридного праймера, соответствующего точке гидролиза ДНК по наиболее метилированному сайту; (в) и (г) – аналогичные данные для гена ESR1. Цифры перед и после нуклеотидной последовательности – координаты по версии генома человека GRCh38.p2 из базы данных GenBank.

 

РЕЗУЛЬТАТЫ И ОБСУЖДЕНИЕ

Выявление сайтов R(5mC)GY, перспективных для GLAD-ПЦР анализа. GLAD-ПЦР анализ сайтов R(5mC)GY проводится в три этапа как описано выше. 

В первой части работы проводили выявление сайтов R(5mC)GY в пределах выбранных участков регуляторных областей генов-онкосупрессоров с целью отбора наиболее метилированных сайтов для дальнейшего GLAD-ПЦР анализа клинических образцов. Для поиска таких сайтов использовали препарат ДНК из клеточной линии SW837. Для каждого из восьми сайтов RCGY, присутствующих в изучаемых фрагментах регуляторных участков генов ELMO1 и ESR1, использовали соответствующий гибридный праймер.

Структура гибридного праймера для каждого эксперимента указана в методах. Гибридный праймер представляет собой последовательность ДНК 5’-CCTGCTCTTTCATCGGYNN-3’, где 5’-концевая 15-тинуклеотидная часть праймера соответствует универсальному олигонуклеотидному адаптеру, а тетрануклеотидная часть на 3’-конце (выделена подчеркиванием), комплементарна геномной последовательности в точке гидролиза ДНК метилзависимой эндонуклеазой GlaI. Данная структура предполагает существование 32 вариантов гибридных праймеров, соответствующих различным концевым последовательностям, получаемых после гидролиза GlaI всех возможных вариантов последовательности NNR(5mC)¯GY.

На рисунке 1 представлены результаты GLAD-ПЦР анализа восьми сайтов R(5mC)GY на изучаемых регуляторных участках генов ELMO1 и ESR1. Как представлено на рисунке, в обоих случаях GLAD-ПЦР анализ показывает метилирование трех сайтов RCGY, расположенных один за другим рядом с последовательностью зонда. При этом, однако, для обоих генов наибольшая степень метилирования наблюдается в третьем по счету сайте от положения зонда (на рисунке его концевая тетрануклеотидная последовательность приведена прописными буквами). Таким образом, в дальнейшей работе мы проводили GLAD-ПЦР анализ сайта GCGC в положении 37448622 на седьмой хромосоме (первый экзон гена ELMO1) и сайта GCGT в положении 151807784 на шестой хромосоме (промотор гена ESR1).

GLAD-ПЦР анализ сайтов метилирования в препаратах ДНК из образцов тканей. В работе мы исследовали ДНК из образцов операционного материала опухолей (n=15) и нормальной слизистой кишечника (n=5) больных колоректальным раком. GLAD-ПЦР анализ двух установленных сайтов GCGC и GCGT в регуляторных участках генов ELMO1 и ESR1, соответственно, проводили с использованием препаратов ДНК из образцов тканей, выделенных, как описано в методах.

Таблица 1 . Число циклов амплификации (Cq) с указанием среднеквадратичных отклонений, полученные по результатам GLAD-ПЦР анализа.

Ген

Тип ткани

Номера образцов

56

75

76

59

54

1

2

16

19

20

25

31

37

50

51

ESR1

Норма

31,53
±1,54

25,75
±0,30

27,08
±0,07

26,36
±0,30

26,76
±0,34

                   

Опухоль

26,76
±0,30

23,51
±0,17

24,06
±0,17

24,41
±0,54

22,87
±0,37

24,8
±0,35

24,67
±0,10

23,68
±0,82

25,35
±0,49

24,44
±1,12

25,78
±0,89

27,55
±0,33

25,05
±0,11

24,93
±0,08

25,45
±0,16

ELMO1

Норма

>34

31,35
±0,40

29,34
±0,08

>34

31,34
±2,00

                   

Опухоль

27,21
±0,40

24,52
±0,05

23,67
±0,17

24,26
±0,06

23,14
±0,02

32,37
±1,56

29,51
±1,20

24,84
±0,22

>34

31,44
±1,11

>34

26,03
±0,27

25,79
±0,26

33,6
±1,10

26,5
±1,01

 

 

ESR1
b_320_200_16777215_00_images_stories_esr1elmo1_ESR1.gif
ELMO1
b_320_200_16777215_00_images_stories_esr1elmo1_Elmo1.gif

Рис.2 Число циклов амплификации Cq для ДНК исследованной группы тканей. По оси абсцисс - номера образцов (“N” - норма, “T” - опухоль), по оси ординат - средние значения Cq по результатам трех повторов с указанием разброса данных. Пунктирными линиями обозначены минимальные значения Cq,полученные для здоровых тканей.

 

Как представлено в таблице в случае сайта GCGT в промоторе гена ESR1 значения Cq для четырех препаратов ДНК из здоровых тканей варьируются от 25,75 до 26,76, и у одного препарата эта величина составляет 31,53. Таким образом, данный сайт слабо метилирован у четырех образцов здоровых тканей и практически неметилирован в образце 56T. Как представлено на рисунке 2 в препаратах ДНК из опухолевых тканей величина Cq меньше, чем в здоровых тканях. Таким образом, в большинстве изученных образцов тканей сайт GCGT в промоторе гена ESR1 более метилирован в опухолевых тканях, чем в здоровых. При этом только в одном образце здоровой ткани этот сайт практически неметилирован.GLAD-ПЦР анализ двух выбранных сайтов проводили в трех повторах, в каждом из которых анализируемый образец ДНК содержал 103 копий гена ELMO1 или ESR1. В таблице 1 представлены полученные результаты GLAD-ПЦР анализа в виде средних значений числа циклов амплификации (Cq) с указанием величин отклонений. На рисунке 2 полученные данные представлены в виде диаграммы.

Представленные на рисунке 2 данные по результатам GLAD-ПЦР анализа сайта GCGC в первом экзоне гена ELMO1 показывают, что для здоровых тканей полученные значения Cq близки к 30 или больше этой величины, что соответствует отсутствию метилирования этого сайта. Схожие величины Cq были получены для шести препаратов опухолевых тканей 1T, 2T, 19T, 20T, 25T и 50T. В то же время для остальных девяти опухолевых тканей Cq варьируется от 23,14 до 27,21, что соответствует заметному метилированию изучаемого сайта GCGC в препаратах ДНК.

Как видно из рис.2 существенное метилирование указанных сайтов в обоих генах наблюдается в опухолевых тканях шести образцов под номерами 16, 37, 54, 59, 75 и 76. Значительное метилирование одного из генов наблюдается еще в шести образцах опухолевых тканей под номерами 1, 2, 31, 50, 51, 56. Эти 12 образцов представляют все четыре стадии заболевания, что соответствует литературным данным о статусе метилировании регуляторных областей генов-онкосупрессоров с развитием опухоли [2, 6].

Перспективы применения GLAD-ПЦР анализа для диагностики. Полученные результаты показывают, что GLAD-ПЦР анализ позволяет выявить сайты R(5mC)GY, возникающие при аберрантном метилировании регуляторных областей генов-онкосупрессоров в опухолевых тканях и клеточной линии SW837. Сайт GCGT в промоторе гена ESR1 слабо метилирован в здоровых тканях, однако в большинстве опухолевых тканей наблюдается увеличение его метилирования. Сайт GCGC в первом экзона гена ELMO1 неметилирован в здоровых тканях и метилируется в 60% образцов опухолевых тканей.

В настоящее время существуют методы определения аберрантно метилированной внеклеточной ДНК в крови пациентов на основе бисульфитной конверсии ДНК [10, 14]. Однако эти методы трудоемки и часто дают ошибочные результаты, в связи с чем, они практически не используются. Применение GLAD-ПЦР анализа позволяет определить наличие аберрантно метилированной внеклеточной ДНК существенно более простым и надежным методом, заключающимся, по сути, в последовательной обработке ДНК двумя ферментами и проведении последующей ПЦР в реальном времени. В дальнейшем мы планируем продолжить работу с образцами тканей для выявления сайтов аберрантного метилирования, пригодных для GLAD-ПЦР анализа, в регуляторных районах других генов-онкосупрессоров. Из набора проверенных сайтов будут отобраны те из них, метилирование которых наблюдается в наибольшем количестве образцов опухолевых тканей при условии отсутствия их метилирования в здоровых тканях. Сформировав панель таких сайтов, мы сможем перейти к GLAD-ПЦР анализу препаратов внеклеточной ДНК из крови пациентов с целью разработки относительно простого и доступного метода лабораторной диагностики колоректального рака.

По результатам работ оформлен патент «Способ определения метилирования сайтов PuCGPy регуляторных областей генов-онкомаркеров колоректального рака методом GLAD-ПЦР-анализа и олигонуклеотидные праймеры и флуоресцентно-меченые зонды для осуществления указанного способа», приоритет от 16.07.15 N 2015129314.

ЛИТЕРАТУРА

  1. Абдурашитов М.А., Чернухин В.А., Томилов В.Н. и др. Рестрикционный анализ ДНК человека – новые возможности в ДНК-диагностике // Мед. генетика. –2007. –Т. 6. –С. 29-36.
  2. Киселева Н.П., Лихтенштейн А.В. Эпигенетические изменения в опухолевых клетках. Роль метилирования ДНК в канцерогенезе // Канцерогенез / Под ред. Д.Г. Заридзе. –М.: Медицина, 2004. –С. 191-203.
  3. Кузнецов В.В., Акишев А.Г., Абдурашитов М.А., Дегтярев С.Х. Способ определения нуклеотидной последовательности Pu(5mC)GPy в заданном положении протяженной ДНК // Патент РФ № 2525710.
  4. Смит К., Клко С., Кантор Ч. Пульс-электрофорез и методы работы с большими молекулами // Анализ генома. Методы / Под ред. К. Дейвиса. –М.: Мир, 1990. –С. 58-94.
  5. Caiazza F., Ryan E.J., Doherty G. et al. Estrogen receptors and their implications in colorectal carcinogenesis // Front. Oncol. –2015. –Vol. 5:19.
  6. de Caseres I.I., Cairus P. Methylated DNA sequences for early cancer detection, molecular classification and chemotherapy response prediction // Clin. Transl. Oncol. –2007. –Vol. 9. –P. 429-437.
  7. Handa V., Jeltsch A. Profound flanking sequence preference of Dnmt3a and Dnmt3b mammalian DNA methyltransferases shape the human epigenome // J. Mol. Biol. –2005. –Vol. 348. –P. 1103-1112.
  8. Kibriya M.G., Raza M., Jasmine F. et al. A genome-wide DNA methylation study in colorectal carcinoma // BMC Med. Genomics. –2011. –Vol. 4:50.
  9. LaPointe L.C., Pedersen S.K., Dunne R. et al. Discovery and validation of molecular biomarkers for colorectal adenomas and cancer with application to blood testing // PLoS One. –2012. –Vol. 7:e29059.
  10. Lao V.V., Grady W.M. Epigenetics and colorectal cancer // Nat. Rev. Gastroenterol. Hepatol. –2011. –V. 8. –P. 686-700.
  11. Mishra D.K., Chen Z., Wu Y. et al. Global methylation pattern of genes in androgen-sensitive and androgen-independent prostate cancer cells // Mol. Cancer Ther. –2010. –Vol. 9. –P. 33-45.
  12. Mitchell S.M., Ross J.P., Drew H.R. et al. A panel of genes methylated with high frequency in colorectal cancer // BMC Cancer. –2014. –Vol. 14:54.
  13. Tarasova G.V., Nayakshina T.N., Degtyarev S.Kh. Substrate specificity of new methyl-directed DNA endonuclease GlaI // BMC Mol. Biol. –2008. –Vol. 9:7.
  14. Umer M., Herceg Z. Deciphering the epigenetic code: an overview of DNA methylation analysis methods // Antioxid Redox Signal. –2013. – Vol. 18. –P. 1972-1986.
  15. Yagi K., Akagi K., Hayashi H. et al. Three DNA methylation epigenotypes in human colorectal cancer // Clin. Cancer Res. –2010. –Vol. 16. –P. 21-33.