Главная  //  Научные статьи  //  Исследование свойств ферментов  //  ДНК-метилтрансфераза FauIA, модифицирующая второй остаток цитозина в непалиндромной последовательности 5'-CCCGC-3' (выделение и свойства)

ДНК-метилтрансфераза FauIA, модифицирующая второй остаток цитозина в непалиндромной последовательности 5'-CCCGC-3' (выделение и свойства)

 

В.А. Чернухин, Ю.Г. Каширина, К.С. Суханова, М.А. Абдурашитов, Д.А. Гончар, С.Х. Дегтярев

Биохимия том 70 вып. 6, 2005, 829 - 837

 

Ген ДНК-метилтрансферазы FauIA из системы рестрикции–модификации FauI (сайт узнавания 5'-CCCGC-3') был клонирован в экспрессирующий вектор pJW, который использовался для трансформации клеток E.coli RR1 с последующей термоиндукцией и наработкой биомассы бактериальных клеток. Высоко очищенный препарат ДНКметилтрансферазы – М.FauIA, был получен с помощью хроматографии на различных носителях. Выделенный фермент имеет молекулярный вес ~39 кДа, что соответствует теоретически установленному молекулярному весу соответствующей рамки трансляции. Изучение свойств полученного фермента показало, что М.FauIA имеет температурный оптимум 33° и проявляет максимальную активность при pH 7,5. Метилированием ферментом М.FauIA синтетического олигонуклеотида с последующим расщеплением различными рестриктазами и анализом полученных продуктов установлено, что М.FauIA модифицирует второй цитозин в последовательности 5-'CCCGC3-'. Определены кинетические параметры реакции метилирования синтетического олигонуклеотидного дуплеска ферментом М.FauIA и показано, что константа Михаэлиса (Km) для этого субстрата составляет 0,16 мкМ, Km для S-аденозил-L-метионина (SAM) равно 0,78 мкМ, а значение каталитической константы (kkat) составило 0,05 мин–1.

 

ДНК-метилтрансферазы (метилазы, М.) – сайт-специфичные ферменты, способные метилировать в ДНК основания (аденин или цитозин) в узнаваемой нуклеотидной последовательности [1]. У прокариот-организмов эти ферменты обычно входят в состав систем рестрикции– модификации (РМ), основной функцией которых является защита клетки от чужеродной ДНК (в частности, ДНК бактериофагов).
Ранее нами был выявлен штамм Flavobacterium aquatile, который продуцирует эндонуклеазу рестрикции FauI, узнающую в двухцепочечной ДНК непалиндромный сайт 5'-CCCGC-3' и расщепляющий ДНК в положении 4/6 относительно этого сайта [2]. Мы клонировали и изучили первичную структуру М.FauIA ДНК-метилтрансферазы [3], установили последовательность ДНК всего оперона, содержащего гены FauI РМ-системы, и показали, что эти гены расположены в необычном порядке, который не встречается в опубликованных ранее последовательностях ДНК других РМ-систем [4].
Большинство систем РМ с непалиндромным сайтом узнавания (подтип IIS), включает либо две ДНК-метилтрансферазы, каждая из которых модифицирует одну из цепей сайта узнавания [5, 6], либо одну ДНК-метилтрансферазу, состоящую из двух доменов, которые отвечают за метилирование разных цепей сайта узнавания [7].
Анализ аминокислотных последовательностей FauI ДНК-метилтрансфераз показал, что обе метилазы из данной системы относятся к классу С5-ДНК-метилтрансфераз [3, 4] и, следовательно, метилируют цитозиновые остатки в положении С5.
Настоящая работа посвящена получению препарата фермента M. FauIA, анализу его субстратной специфичности и изучению зависимостей активности фермента от температуры, величины pH и концентраций двух субстратов.

 

МЕТОДЫ ИССЛЕДОВАНИЯ

 

Штаммы и реактивы

Мы использовали бактериальные штаммы Flavobacterium aquatile I из коллекции штаммов НПО «СибЭнзим» (Новосибирск, Россия) и Escherichia coli RRI («New England Biolabs», СШA), а также следующие реактивы и компоненты питательных сред: Tris («Promega», США), акриламид, бис-акриламид, ампициллин и белковый маркер для электрофореза («Хеликон», Россия), ЭДТА («Fluka AG», Швейцария), агароза («Hybaid-AGS», Германия), глицерин, 2-меркаптоэтанол, дитиотреитол (ДТТ), Triton Х-100 («ICN», США), лизоцим («Serva», Германия), S-аденозил-L-метионин (SAM) («New England Biolabs», США), [3H-CH3]SAM («Amersham», Англия), дифенилметилсульфонилфторид (PSMF) («Sigma», США), фосфоцеллюлоза P-11 («Whatman», Англия), гидроксилапатит, гепаринсефароза («Bio-Rad», США), сефакрил S-200, триптон и дрожжевой экстракт («Organotechnie», Франция), ферменты и препараты ДНК (НПО «СибЭнзим», Россия). Остальные реагенты – отечественного производства квалификации х.ч.



Получение биомассы M. FauIA

Ген M.FauIA был клонирован в векторе pJW [8] по сайтам рестрикции BamHI и FauNDI под термоиндуцибельный промотор фага λ. Для термоиндуцируемой наработки фермента использовали штамм E.coli RRI. Трансформированные плазмидой M.FauIA-pJW клетки высевали в жидкую питательную среду LB, содержащую триптон (10 г/л), дрожжевой экстракт (5 г/л), NaCl (5 г/л), pH 7,0–7,3, и ампициллин 100 мкг/мл. Биомассу наращивали в колбах на термостатированной качалке при 30° и 180 об/мин до оптической плотности А550 0,8–0,9. Далее проводили термоиндукцию при 42°C в течение 4 ч. Клетки собирали центрифугированием при 3000 g и хранили при –20°C. Наличие индуцируемого белка проверяли с помощью электрофореза в денатурирующем ПААГ. Для этого аликвоты лизата клеток наносили на Ds-Na–ПААГ и проводили электрофорез по стандартной методике [9]. На рис.1 приведена электрофореграмма клеточного лизата штамма E.coli RRI, содержащего плазмиду M.FauIA-pJW. Видно, что после термоиндукции в клетках появляется белок, молекулярная масса которого близка к 39 кДа, что соответствует теоретически вычисленной молекулярной массе аминокислотной последовательности, предсказанной на основе первичной структуры открытой рамки считывания – 38 956 Да [4].

Электрофореграмма клеточного лизата штамма RRI E. сoli

 

 

Рис. 1. Электрофореграмма клеточного лизата штамма RRI E. сoli, несущего вектор M.FauA-pJW, препарата фермента. Дорожки: 1 – до термоиндукции, 2 – после термоиндукции (стрелкой указана полоса, соответствующая M.FauIA), 3 – конечный препарат фермента, 4 – маркеры молекулярных масс (цифры справа указывают их молекулярные массы, Да)

 

 


Выделение фермента M.FauIA

Все стадии процесса выделения проводили при температуре 4°. Биомассу (12 г) суспендировали в 35 мл буфера А (10 мМ Tris-HCl, pH 7,5, при 25°, 10 мМ β-меркаптоэтанол, 0,1 мМ ЭДТА, 5%-ный глицерин), содержащего 0,3 мг/мл лизоцима, в течение 40 мин. Стакан с суспензией помещали в ледяную баню и обрабатывали ультразвуком в дезинтеграторе Soniprep 150 («MSE», Англия) 6 раз по 30 с с интервалами в 1 мин с амплитудой 22–24 мкм. После минуты обработки добавляли Тriton X-100 до концентрации 0,1%. Обломки клеток удаляли центрифугированием при 15 000 об/мин при 4° в течение 30 мин на центрифуге J2-21 («Beckman», США).
Супернатант переносили в стакан, добавляли ингибитор протеаз PMSF, NaCl до концентрации 0,2 М и 20 мл фосфоцеллюлозы P-11, предварительно уравновешенной буфером А, содержащим 50 мМ NaCl. Смесь перемешивали в течение 1 ч, наносили на колонку (10 см x 20 мм) и промывали 40 мл буфера А с 0,2 М NaCl. Сорбированный материал элюировали линейным градиентом концентрации NaCl 0,2 М–0,9 М в буфере А объемом 200 мл. Собирали 50 фракций по 4 мл.
Фракции с максимальной ДНК-метилтрансферазной активностью (рис. 2) объемом 5 мл наносили на колонку (10 см x 20 мм) с гидроксилапатитом (ГАП), предварительно уравновешенную буфером В (10 мМ KH2PO4, pH 7,2, при 25°, 0,1 мМ ЭДТА, 10 мМ β-меркаптоэтанол, 5%-ный глицерин, 0,2 М NaCl). Скорость нанесения фракций на колонку – 30 мл/ч. Колонку промывали двумя объемами буфера В. Фермент элюировали линейным градиентом KH2PO4 10–300 мМ в буфере В объемом 120 мл со скоростью 30 мл/ч. Собирали 50 фракций по 2,4 мл. Фермент элюировался при 100–155 мМ KН2PO4. Фракции, обладающие наибольшей активностью, объединяли и диализовали против 100 мл концентрирующего буфера, содержащего 50%-ный глицерин, 10 мМ Tris–HCl (pH 7,5 при 25°), 10 мМ β-меркаптоэтанол, 0,1 мМ ЭДТА и 0,2 М NaCl при постоянном перемешивании на магнитной мешалке в течение 16 ч. Препарат концентрировали и наслаивали на колонку (70 см x 16 мм) с сефакрилом S200 объемом 30 мл, предварительно уравновешенную буфером А с 0,3 М NaCl, 7%-ным глицерином и 14 мМ β-меркаптоэтанолом. Элюцию проводили 30 мл этого же буфера со скоростью 6 мл/ч. Отобрали 20 фракций по 1,5 мл.
Фракции, содержащие метилазную активность, объединяли и наносили на колонку с ГАП объемом 4 мл, предварительно уравновешенную буфером В, со скоростью 30 мл/ч. Колонку промывали двумя объемами буфера В. Элюцию осуществляли линейным градиентом KH2PO4 10–300 мМ в буфере В объемом 100 мл. Собирали 40 фракций по 2,5 мл.
Из полученных фракций отобрали, обладающие ДНК-метилтрансферазной активностью, и диализовали против 100 мл концентрирующего буфера при перемешивании на магнитной мешалке в течение 10 ч при 4°.



Определение ДНК-метилтрансферазной активности в профиле

Активность метилаз в хроматографическом профиле тестировали по защите ДНК фага λ, инкубированной с аликвотами из фракций, от гидролиза эндонуклеазой рестрикции FauI. Для этого отбирали из фракций аликвоты по 2 мкл и добавляли к 10 мкл реакционной смеси, содержавшей 0,5 мкг ДНК фага λ в SE-буфере 5 (Y) (33 мМ Tris-ацетат, pH 7,9, 10 мМ ацетат магния, 66 мМ ацетат калия, 1 мМ ДТТ) и 160 мкМ SAM. Смесь инкубировали при 37° в течение 30 мин, затем добавляли по 1 мкл препарата эндонуклеазы рестрикции FauI и выдерживали еще 30 мин при 55°. Продукты реакции разделяли в 1%-ном агарозном геле, окрашивали раствором этидия бромистого и наблюдали в УФ-свете. Результаты тестирования фракций, полученных после первой стадии очистки на фосфоцеллюлозе, по защите ДНК фага λ от гидролиза эндонуклеазой рестрикции FauI приведены на рис. 2.
Присутствие во фракциях примесных белков определяли с помощью электрофореза в денатурирующем ПААГ. Для этого аликвоты из фракций по 25 мкл наносили на Ds-Na-ПААГ и проводили электрофорез по стандартной методике [9].

 

Электрофореграмма в 1%-ной агарозе профиля активности после первой стадии хроматографии на фосфоцеллюлозе

Рис. 2. Электрофореграмма в 1%-ной агарозе профиля активности после первой стадии хроматографии на фосфоцеллюлозе. Тестирование активности фермента проводилось по защите ДНК фага λ от гидролиза эндонуклеазой рестрикции Fau1. Дорожки: 1 – свободный объем колонки, 2–18 – каждая третья фракция, начиная с первой, 12, 13 – фракции, в которых проявляется значительная ДНК-метилтрансферазная активность, 19 – исходная реакционная смесь без добавления аликвот из фракций и рестриктазы, 20 – гидролизат неметилированной ДНК фага λ рестриктазой FauI

 


Определение количества включенных в ДНК метильных групп

Для проведения реакции метилирования использовали реакционную смесь, содержащую 100 мМ Tris-HCl с фиксированным pH, 1 мМ ЭДТА, 1 мМ ДТТ, БСА (0,2 мг) и меченный тритием SAM.
При измерении температурной зависимости активности фермента, pH-зависимости и зависимости скорости реакции от концентрации одного из субстратов время реакции подбирали так, чтобы концентрация продуктов не превышала 10%.
Реакцию метилирования останавливали нанесением аликвоты на фильтр ДЕ81 («Whatman»), который затем трижды промывали в 0,02 М водном растворе NaHCO3 по 20 мин, затем водой. После высушивания фильтра измерение радиоактивности проводили на сцинтилляционном счетчике Марк III.

 

Статистическая обработка результатов

Для вычисления каталитической константы и констант Михаэлиса по разным субстратам использовался регрессионный анализ, проводимый с помощью программы Origin 5.0.

 

РЕЗУЛЬТАТЫ И ИХ ОБСУЖДЕНИЕ

 

Получение препарата M.FauIA

Схема очистки метилазы M.FauIА состояла из четырех хроматографических стадий в следующем порядке: хроматография на фосфоцеллюлозе P-11, гидроксилапатите, сефакриле S200 и рехроматография на гидроксилапатите. В ходе очистки фракции, содержащие наибольшую ферментативную активность, объединяли и концентрировали после последней стадии путем диализа против буфера хранения. Было получено 2,5 мл препарата фермента M.FauIА с концентрацией 0,73 мг/мл. Чистоту препарата проверяли с помощью денатурирующего белкового электрофореза в 10%-ном ПААГ ( рис. 1).
Молекулярная масса очищенного фермента составляет ~39 кДа, что соответствует молекулярной массе, рассчитанной из аминокислотной последовательности метилазы FauIA.



Анализ температурной зависимости активности M.FauIA

Температурную зависимость активности фермента измеряли по уровню метилирования ДНК фага λ за 10 мин реакции. Температурный оптимум фермента ~33° и при дальнейшем повышении температуры его активность резко уменьшается (рис. 3, а). Так, при 43° активность фермента на три порядка ниже, чем при оптимальной температуре. По температурной зависимости ДНК-метилтрансфераза M.FauIA резко отличается от эндонуклеазы рестрикции FauIA, температурный оптимум которой составляет 55°. Пока это единственный известный пример различия по оптимальной температуре реакции (более чем на 20°) между метилазой и рестриктазой из одной и той же системы рестрикции–модификации. Такое различие лишний раз свидетельствует об уникальности изучаемой нами РМ-системы FauI. Все дальнейшие эксперименты проводились при 33°.

 

Зависимость активности M.FauIA от pH

Наибольшую активность фермент проявляет в диапазоне pH 7,0–8,5, что соответствует обычному pH-оптимуму для ДНК-метилтрансфераз; оптимальная величина pH для фермента составляет 7,5 (рис. 3, б). Далее метилирование проводили при рH 7,5.

 

Зависимости скорости метилирования ДНК ферментом фага лямбда М.FauIA

 

 Рис. 3. Зависимости скорости метилирования ДНК фага λ ферментом М.FauIA (концентрации: фермента – 900 нМ, ДНК фага λ в пересчете на сайты 5'-CCCGC-3' – 500 нМ, SAM – 5 мкМ): а – от температуры (время реакции 10 мин), б – от рН (время реакции 15 мин)

 

 


Определение метилируемого основания в сайте узнавания

Для дальнейших экспериментов использовали синтезированный олигонуклеотидный дуплекс, содержащий сайт 5'-CCCGC-3'. Первичная структура одной из двух комплементарных цепей этого дуплекса изображена на рис. 4.

 

Структура синтетического олигонуклеотида, использованного при определении метилируемого нуклеотидного остатка. Жирным шрифтом выделен сайт узнавания ферментов РМ-системы FauI

 

Рис. 4. Структура синтетического олигонуклеотида, использованного при определении метилируемого нуклеотидного остатка. Жирным шрифтом выделен сайт узнавания ферментов РМ-системы FauI. Сверху приведены названия и сайты узнавания эндонуклеаз рестрикции, а стрелками показаны их позиции расщепления на олигонуклеотиде

 


Чтобы определить метилируемое основание, необходимо было убедиться, что в данном дуплексе метилируется только один нуклеотид. Для этого было проведено исчерпывающее метилирование дуплекса, концентрация которого в реакционной смеси составляла 1 мкМ. Концентрацию метилированной ДНК определяли по количеству импульсов в минуту включенной в ДНК тритиевой метки. Результаты данного опыта приведены на рис. 5. Через 1 ч после начала реакции концентрация метилированной ДНК выходит на плато и составляет 1 мкМ, что соответствует концентрации дуплекса в реакционной смеси. Таким образом, в данном дуплексе метилируется только один нуклеотид. Этот модифицированный субстрат был использован для определения позиции метилируемого основания.

Зависимость концентрации метилированных в дуплексе сайтов от времени инкубации

 

 

 

Рис. 5. Зависимость концентрации метилированных в дуплексе сайтов от времени инкубации (концентрации: M.FauIA – 1,7, дуплекса – 1 и SAM – 5 мкМ)

 

 

 


Для этого метилированный олигонуклеотид (после введения меченной тритием метильной группы в дуплекс с помощью M.FauIA) был расщеплен отдельно тремя рестриктазами – AclWI, FriOI и AsuNHI. Фрагменты, полученные после гидролиза, были разделены электрофорезом в 20%-ном ПААГ. Присутствовавшая в геле мочевина (8 М) обеспечивала денатурацию двухцепочечной ДНК. Полученные рестрикционные фрагменты элюировали из геля и переносили на фильтры ДЕ81, на которых измеряли количество включенной метки. Результаты измерения радиоактивности (импульсы в минуту) для каждого рестрикционного фрагмента приведены в табл. 1.

 

Рестриктазы, используемые для гидролиза

Образуемые фрагменты

Верхняя цепь

Нижняя цепь

Последовательность рестрикционного фрагмента

Импульсы в минуту

Последовательность рестрикционного фрагмента

Импульсы в минуту

FriOI

 

AsuNHI

 

AclWI

5'- GAAGAAGGATCGAGCC -3'

5'- CGCTAGCAAG -3'

5'- GAAGAAGGATCGAGCCCG -3'

5'- CTAGCAAG -3'

5'- GAAGAAGGATCGAGC -3'

5'- CCGCTAGCAAG -3'

876

60

980

121

58

830

5'- CGATCCTTCTTC -3'

5'- CTTGCTAGCGGGCT -3'

5'- CTAGCGGGCTCGATCCTTCTTC -3'

5'- CTTG -3'

5'- GGGCTCGATCCTTCTTC -3'

5'- CTTGCTAGC -3'

85

55

141

50

45

52

Таблица 1. Количество импульсов в минуту, излучаемых мечеными тритием рестрикционными фрагментами, полученными после гидролиза рестриктазами AclWI , FriOI и AsuNHI . Жирным шрифтом выделена последовательность, узнаваемая рестриктазой FauI


Из данных, представленных в этой таблице, можно сделать вывод, что метилаза FauIA метилирует верхнюю цепь, причем метильная группа включается во второй цитозиновый остаток последовательности сайта 5'-CCCGC-3'.

 

Определение стационарных кинетических параметров для M.FauIA

Измерение стандартных кинетических параметров реакции метилирования ДНК, катализируемой M.FauIA, проводили с использованием олигонуклеотидного дуплекса как субстрата реакции, который, как описано выше, использовали для определения метилируемого основания в сайте узнавания фермента.
В соответствии с условиями определения кинетических констант согласно уравнению Михаэлиса–Ментен измерение зависимости скорости метилирования от концентрации одного из субстратов проводили при насыщении по другому субстрату. На рис. 6, а изображена зависимость скорости метилирования от концентрации дуплекса.
Значение константы Михаэлиса, вычисленное регрессионным анализом на основе этих данных, составило 0,17 ± 0,04 мкМ. Значение каталитической константы составило 0,050 ± 0,005 мин–1.
Для анализа зависимости скорости метилирования ДНК от концентрации второго субстрата (SAM) мы использовали концентрацию сайтов метилирования, равную 1 мкМ. Зависимость скорости метилирования от концентрации SAM приведена на рис. 6, б. На основании полученных данных значение константы Михаэлиса составило 0,78 ± 0,08 мкМ.

Зависимости скорости метилирования ДНК ферментом: а – от концентрации ДНК

 

Рис. 6. Зависимости скорости метилирования ДНК ферментом: а – от концентрации ДНК (время реакции 50 мин, концентрации: фермента – 30 нМ и SAM – 5 мкМ), б – от концентрации SAM (время реакции 40 мин, концентрации: фермента – 200нМ и ДНК – 1 мкМ)

 


Сравнение полученных результатов с литературными данными показывает, что для большинства изученных прокариотических ДНК-метилтрансфераз, модифицирующих цитозин в положении С5, значения каталитической константы оказываются выше, тогда как значения константы Михаэлиса для ДНК и SAM – наоборот, ниже по сравнению с изучаемой ДНК-метилтрансферазой (табл. 2). При этом, как видно из данных таблицы, сайты узнавания всех остальных ДНК-метилтрансфераз, в отличие от M.FauIA, являются палиндромными. По-видимому, такое различие кинетических параметров связано именно с несимметричностью сайта узнавания M.FauIA. Действительно, для ряда подобных ферментов, узнающих непалиндромные сайты узнавания, например, для C- и N-концевыех доменов M. FokI [14], метилаз РМ-системы BstFI5 [15], показано, что каталитические константы для них значительно ниже, чем для ферментов, модифицирующих палиндромные сайты узнавания (табл. 3).
Известно, что ДНК-метилазы, модифицирующие палиндромные сайты узнавания, являются в большинстве своем функциональными димерами, что, видимо, и обусловливает более высокие каталитические константы этих ферментов по сравнению с таковыми у ферментов с непалиндромными сайтами узнавания, действующими в виде мономеров. Интересно отметить, что из всех С5-цитозиновых ДНК-метилтрансфераз, приведенных в табл. 2, по свойствам M.FauIA наиболее близка М.EcoRII, хотя даже при этом каталитическая константа для M.FauIAв 7 раз меньше, чем для М.EcoRII. Известно, что М.EcoRII функционирует тоже как мономер [12], и, видимо, поэтому по своим свойствам она наиболее близка М.FauIА.

 

ДНК-метилтрансфераза kкат , мин –1 KmДНК , нМ KmSAM , мкМ Источник

Fau IA

0,052

168

0,776

Данная работа

Msp I

3,36

7,1

0,016

[10]

Hha I

5,1

4,0

0,16

[11]

Eco RII

0,36

15

[12]

Eco HK31I*

3,0

2,0

0,58

[13]

Таблица 2. Значение каталитических параметров для прокариотических С5-ДНК-метилтрансфераз. Каталитические параметры измерялись на олигонуклеотидных дуплексах, за исключением случаев, отмеченных отдельно
* Каталитические параметры измерялись на плазмиде pWM 2372

 

 

ДНК-метилтрансфераза

kкат , мин–1

KmДНК, нМ

KmSAM, мкМ

Источник

Bam HI

3,24

350

1,6

[16]

Eco Dam

6,6

55

2,6

[17]

Eco RI

7,2

2,4

0,12

[18]

Fok I, N-концевой домен

0,0007

1240

[14]

Fok I, С-концевой домен

0,024

230

[14]

Bst F5I-2

2,6

720

0,67

[15]

Bst F5I-4

0,99

1290

0,94

[15]

Таблица 3. Значение каталитических параметров для прокариотических N4- и N6-ДНК-метилтрансфераз


Высокое значение Кm (ДНК) для M.FauIA по сравнению с другими ДНК-метилтрансферазами, видимо, также связано с мономерным характером действия фермента и несимметричностью сайта узнавания в субстрате. Аналогичные, аномально высокие значения Кm (ДНК), были нами получены ранее для двух ферментов РМ-системы BstFI5 [15], также имеющих несимметричный сайт узнавания.
На рис. 7 приведена зависимость концентрации включенных в ДНК фага λ метильных групп ферментом M.FauIA от времени инкубации. Видно, что фермент включает в ДНК метильные группы в концентрации большей, чем концентрация присутствующих в ней сайтов 5'-CCCGC-3'. В то же время модификация олигонуклеотидного дуплекса происходит практически стехиометрически, что свидетельствует о дополнительном метилировании в ДНК λ фага каких-то сайтов, отсутствующих в структуре данного олигонуклеотида.

Зависимость концентрации метилированных сайтов ДНК фага лямбда от времени

 

 

Рис. 7. Зависимость концентрации метилированных сайтов ДНК фага λ от времени (концентрации сайтов 5'-CCCGC-3' фага λ – 378 нМ, фермента М.FauIA – 1,8 мкМ и SAM – 5 мкМ)

 

 

 


Способность метилировать неканонические сайты изучена слабо. Она показана для ДНК-метилтрансфераз, как входящих в РМ-системы, так и не имеющих соответствующей рестриктазы. Так, метилазы EcoDam и T4Dam, обычно метилирующие аденин в последовательности 5'-GATC-3', могут модифицировать аденин и в более короткой последовательности 5'-GAT-3' со скоростью, не намного меньшей скорости канонического метилирования [19, 20]. Возможность неканонического метилирования ферментами, входящими в состав РМ-систем, показана как для метилаз, модифицирующих палиндромные сайты [21, 22], так и для метилтрансфераз, узнающих непалиндромные последовательности [14]. Можно предположить, что это явление не является редким, оно встречается у многих РМ-систем.

 

СПИСОК ЛИТЕРАТУРЫ

  1. Dryden, D.T.F. (1999) in S-adenosylmethionine-dependent methyltransferases: structures and functions (Cheng, X., and Blumenthal, R.M., eds) World Scientific, Singapore, pp. 283–340.
  2. Дегтярев С.Х., Колыхалов А.А., Речкунова Н.И., Дедков В.С. (1989). Биоорган. химия, 15, 130–132.
  3. Degtyarev, S.Kh., Netesova, N.A., Chizhikov, V.E., and Abdurashitov, M.A. (1998) Biol. Chem., 379, 567–568.
  4. Абдурашитов М.А., Охапкина С.С., Нетесова Н.А., Голикова Л.Н., Гончар Д.А, Дегтярев С.Х. (2003) Мол. биология, 37, 619–624.
  5. Sugisaki, H., Yamamoto, K., and Takanami, M. (1991) J. Biol. Chem., 266, 13952–13957.
  6. Bitinaite, J., Maneliene, Z., Menkevicius, S., Klimasauskas, S., Butkus, V., and Janulaitis, A.A. (1992) Nucl. Acids Res., 20, 4981–4985.
  7. Friedrich, T. , Fatemi, M., Gowhar, H., Leismann, O., and Jeltch, A. (2000) Biochim. Biophys. Acta., 1480, 145–159.
  8. Kossykh, V.G., Schlagman, S.L., and Hattman, S.M. (1995) J. Biol. Chem., 270, 14389–14393.
  9. Sambrook, J., Fritsch, E.F., and Maniatis, T. (1989) Molecular cloning, Cold Spring Harbor Laboratory Press.
  10. Bhattacharya, S.K., and Dubey, A.K. (1999) J. Biol. Chem., 274, 14743–14749.
  11. Wu, J.C., and Santi, D.V. (1987) J. Biol. Chem., 262. 4778–4786.
  12. Gabbara, S., Sheluho, D., and Bhagwat, A.S. (1995) Biochemistry, 34, 8914–8923.
  13. Lee, K.F., Liaw, Y., and Shaw, P.C. (1996) Biochem. J., 314, 321–326.
  14. Leismann, O., Roth, M., Friedrich, T. , Wende, W., and Jeltsch, A. (1998) Eur. J. Biochem., 251, 899–906.
  15. Чернухин В.А., Голикова Л.Н., Гончар Д.А., Абдурашитов М.А., Каширина Ю.Г., Нетесова Н.А., Дегтярев С.Х. (2003) Биохимия, 68, 1183–1192.
  16. Malygin, E.G., Ovechkina, L.G., Zinoviev, V.V., Lindstrom, W.M., and Reich, N.O. (2001) Mol. Biol. (Moscow)., 35, 35–44.
  17. Thielking, V., Dubois, S., Eritja, R., and Guschlbauer, W. (1997) Biol. Chem., 378, 407–415.
  18. Reich, N.O., and Mashhoon, N. (1991) Biochemistry, 30, 2933–2939.
  19. Buryanov, Y.I., Zinoviev, V.V., Gorbunov, T.A., Tuzikov, F.V., Rechkunova, N.I., Malygin, E.G., and Batev, A.A. (1988) Gene, 74, 67–69.
  20. Malygin, E.G., Petrov, N.A., Gorbunov, T.A., Kossykh, V.G., and Hattman, S.M. (1997) Nucl. Acids Res., 30, 3880–3885.
  21. Reich, N.O., and Mashhoon, N. (1991) Biochemistry, 30, 2933–2939.
  22. Cohen, H.M., Tawfik, D.S., and Griffiths, A.D. (2002) Nucl. Acids Res., 30, 3880–3885.